alexa Isolation and Characterization of Bacteriophage against Methicillin Resistant Staphylococcus aureus | Open Access Journals
ISSN: 2161-0703
Journal of Medical Microbiology & Diagnosis
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Isolation and Characterization of Bacteriophage against Methicillin Resistant Staphylococcus aureus

Mariem N Mohammed-Ali* and Nidham M. Jamalludeen

Department of Microbiology, College of Medicine, University of Basrah, Basrah, Iraq

*Corresponding Author:
Mariem N. Mohammed-Ali
Department of Microbiology
College of Medicine, University of Basrah
Basrah, Iraq
Tel: 964 1886 8520
E-mail: [email protected]

Received Date: October 30, 2015; Accepted Date: December 28, 2015; Published Date: December 30, 2015

Citation: Mohammed-Ali MN, Jamalludeen NM (2015) Isolation and Characterization of Bacteriophage against Methicillin Resistant Staphylococcus aureus. J Med Microb Diagn 5:213. doi: 10.4172/2161-0703.1000213

Copyright: © 2015 Mohammed-Ali MN, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Medical Microbiology & Diagnosis

Abstract

Methicillin resistant Staphylococcus aureus (MRSA) is a major human pathogen responsible for several life threatening conditions. MRSA have the ability to acquire resistance to several antimicrobial agents and phage therapy is one potential option to treat this pathogen. The aim of the study was to isolate and characterize bacteriophages effective against a wide range of methicillin-resistant Staphylococcus aureus (MRSA). A mixture of ten MRSA isolates was used for the isolation of phage from wastewater treatment plants. Three phages were selected for further characterization. All three phages belong to the Siphoviridae family and have long non-contractile flexible tails. The three phages showed a wide host range against S. aureus. Phages ɸSA1 and ɸSA2 were resistant to a pH range from 4-10 while ɸSA3 has a pH range from 3-11. DNA from all three phages was resistant to digestion by endonuclease enzymes such as EcoRI and AccI. There was a high degree of mosaicism among the three virulent phages and with their ancestor phages of Siphoviridae due to their non-uniform access to the common genetic pool by horizontal gene transfer and recombination. Since some of the staphylococcal toxins are phage encoded, the presence of genes for such toxins was tested by performing polymerase chain reaction and all three phages lacked genes for any of the staphylococcal toxins, including staphylococcal enterotoxins (sea, seb, sec and see), exfoliating toxins (eta and etb) and the toxic shock syndrome toxin (tst), therefore these bacteriophage are suitable candidates for future use in phage therapy against MRSA.

Keywords

Staphylococcus aureus; Phage therapy; MRSA phage; Siphoviridae; Anti-restriction mechanism; Mosaicism

Introduction

Methicillin-resistant Staphylococcus aureus (MRSA) is a worldwide pathogen that is responsible for a variety of diseases ranging from soft tissue and skin infections to life threatening conditions such as pneumonia, bacteremia and sepsis [1]. MRSA is one of the major human pathogens that may cause community and hospital acquired infections [2]. These organisms are frequently resistant to most of the commonly used antimicrobial agents, including β-lactam antibiotics [3]. The emergence and spread of strains resistant to oxacillin, methicillin and even vancomycin has made therapy of these multi drug resistant bacteria a global challenge [4]. MRSA has a wide variety of virulence factors that include structural and secreted factors [5]. These factors include superantigens, cytolytic toxins, exoenzymes and miscellaneous proteins [6]. Superantigens are a group of powerful immuno-stimulatory proteins implicated in a variety of human diseases including gastroenteritis and toxic shock syndrome [7].

One possible approach to treatment of methicillin resistant S. aureus is phage therapy, defined as the application of phage to selectively reduce or eliminate susceptible pathogens from specific environments [8]. Phage therapy may be a suitable alternative to antibiotic treatment due to the high specificity of and effectiveness against multi drug resistant bacteria [9,10]. The use of bacteriophages in clinical medicine was first introduced by Félix d’Herelle [11]. Many therapeutic phages have been isolated against MRSA, most of which belong to the Myoviridae family such as the well-known phage K and MR-10 [12,13]. Since all tailed phages are believed to share common ancestors, a high frequency of chimeric and mosaic structures can be observed among different tailed phage families due to their access to a common genetic pool [14,15]. Such mosaicism has resulted in a high degree of similarity among phages in both nucleic acids and proteins [16]. The main aims of this study were to isolate a set of bacteriophages effective against a wide range of MRSA isolates and characterize these phages according to their morphological features, host range, endonuclease enzyme digestion pattern, molecular identification, the presence of undesirable toxin encoding genes.

Materials and Methods

Culture media and chemicals

The following media and chemicals were used for the study: brain heart infusion agar (Salucea, Netherlands), brain heart infusion broth (HIMEDIA, India), blood agar (HIMEDIA, India), mannitol salt agar (OXOID, England), Mueller Hinton agar (HIMEDIA, India), Agar agar (HIMEDIA, India), agarose (Bio Basic, Canada), peptone (DIFCO, USA), beef extract (OXOID, England), yeast extract (Sigma-Aldrich, Switzerland), sodium chloride (Sigma-Aldrich, Switzerland), sodium hydroxide (Sigma-Aldrich, Switzerland), potassium dihydrogen phosphate (Sigma-Aldrich, Switzerland), Gelatin (BDH, England), barium chloride (Hopkins and Williams Limited, England), Gram stain (HIMEDIA, India), catalase test reagent (HIMEDIA, India), coagulase plasma (HIMEDIA, India), API Staph (bioMérieux, France), EcoRI (promega, USA), AccI (BioLabs, New England), sulfuric acid (BDH, England), hydrochloric acid (BDH, England), tris-(hydroxymethyl)- aminomethane (pH 7.5) (Riedel-deHaën, Germany), Chloroform (Sigma-Aldrich, Switzerland), glycerol (Chem-supply, Australia), absolute ethanol (BDH, England), nuclease free water (Promega, USA), ethidium bromide (Fisher, USA), bromophenol blue (Fisher, USA), TBE buffer (Promega, USA), TE buffer (Promega, USA), (Bioanalyse, USA), cefoxitin disc (30 μg) (Bioanalyse, USA), DNA ladder marker (100-1000 bp) (Promega, USA) and DNA ladder marker (100-10000 bp (KAPA, USA).

Sample collection

A total of 100 isolates of staphylococci were obtained from various clinical sources such as skin, anterior nares, ear wound, sputum, blood and urine all according to standard methods of sample collection [17]. The isolates were randomly collected from healthcare workers, hospital patients and patient’s escorts at Al-Sadar hospital, Al-Basra General Hospital, Ibn Ghazwan Hospital and day care centers in Basra.

MRSA identification

Staphylococcus aureus isolates were identified by standard methods described [17]. Staphylococcus aureus isolates isolates were characterized as methicillin resistant (MRSA) using the cefoxtin disc (30 μg) diffusion method [18]. The diameter of the zone of inhibition was measured and the results were interpreted according to CLSI criteria [19].

Isolation of bacteriophage

Bacteriophages were isolated from raw sewage samples obtained from Al-Sadar hospital raw sewage in Basra according to previously described methods [20,21]. A 200 ml volume of fresh sewage was mixed with 20 ml of bacteriophage broth [peptone (100 g/L), beef extract (30 g/L), yeast extract (50 g/L), sodium chloride (25 g/L), potassium dihydrogen phosphate (80 g/L)], 20 ml of a mixture of 2 MRSA strains (ATCC 25923 and ATCC 29213) in broth culture (optical density at 600 nm (OD600 = 1.4) and 20 ml of BHI broth were aseptically added to a 1 L flask and incubated at 37ºC for 24 h with shaking (55 rpm). After incubation, the mixture was centrifuged at 4500 xg for 15 min and the supernatant was transferred into a clean flask and then filtered through a sterile 0.45 μm membrane filter (chm, Spain). The phage titre was determined by serial dilution in which 100 μl volumes of the filtrate was mixed with 100 μl of broth culture containing MRSA in a test tube and incubated at 37ºC for 20 min then 3 ml of top agarose (7.0 g/L) was added, the tube contents were then mixed and poured onto the surface of a BHI agarose plate and allowed to harden for a few minutes and then incubated at 37ºC for 16 h. Next day, the plates were examined for the presence of plaques. A control tube containing bacteria and 3 ml of top agarose without filtrate was also cultured on a BHI agarose plate.

A sterile Pasteur pipette with a rubber bulb was used to gently suction a well-isolated plaque. The pipette contents were transferred into a tube containing 1 ml of SM buffer (5.8 g/L NaCl, 2 g/L MgSO4 7H2O, 50 ml/L of 1 M Tris pH 7.5, 5 ml/L of 2% gelatin) and 1 drop of chloroform was added to each tube. The tubes were held at room temperature for 1–2 h to allow the bacteriophage particles to diffuse out of the agar. The phage titre was determined by the soft agarose overlay method and finally the phages were stored at 4ºC until stocks were prepared.

Bacteriophage stock preparation

Bacteriophage stock was prepared according to Sambrook et al. [21]. A 100-μl volume of bacteriophage suspension was incubated with 100 μl of the selected host bacterium for 20 min at 37ºC, and then 3 ml of top agarose was added, mixed and poured onto a BHI agarose plate which was incubated for 6-8 h at 37ºC. A 2 ml volume of SM buffer was then added to each plate in order to harvest the phages and then was transferred into tubes containing 0.2 ml of chloroform. The mixture was kept at 4 ºC for 2-3 h and gently vortexed and centrifuged at 4500 x g for 15 min. The supernatant was recovered and a drop of chloroform was added. The supernatant was filtered through a sterile 0.45 μm membrane filter (chm, Spain) and the filtrate was stored at 4ºC and the titres of the phage stocks were determined by plaquing 10-fold dilutions using the soft agarose overlay method. The phage stock was purified for further studies by layering 4 ml of 5% glycerol solution in SM buffer over 40% glycerol and adding the sample on the top, followed by ultracentrifugation at 25000 x g, for 2 h at 4ºC. The phage-containing pellet was resuspended in 1 ml SM buffer.

Electron microscopy

Phage particles were negatively stained with 2% uranyl acetate (Sigma-Aldrich, Switzerland) on carbon-coated copper grid using standard procedures. TEM images were captured in Zeiss EM10C (Zeiss, Germany) at Khajeh Nasir Toosi University of Technology (IRAN). Three phages that were isolated were classified according to the International Committee on Taxonomy of Viruses ICTV [22].

Host range

The host range of each of the isolated bacteriophages was determined against a number of MRSA isolates as described by Jamalludeen et al., [20]. A lawn of a single MRSA isolate was inoculated on a BHI agar plate and the plate was divided into four squares by marking the surface of the plate. The plate was left to dry for a few minutes and then 10 μl of each phage suspension (109 pfu/ml) was dropped in the center of each square except for one square which was left as control. Following incubation at 37ºC for 24 h, these plates were examined for lysis. A clear zone in the bacterial lawn was recorded as complete lysis.

Resistance of phages to acidity and alkalinity

Resistance of phages to acidity and alkalinity was done according to Jamalludeen et al. [20]. A 100 μl volume of phage suspension (109 pfu/ ml) was added to 900 μl of saline adjusted to a specific pH. The mixture was incubated at 37ºC for 16 h. A control sample (phage suspension and normal saline, pH 7.2) was also incubated at 37ºC for 16 h. The titre of the surviving phages was determined by plaquing 10-fold dilutions by the soft agarose overlay method.

Extraction of bacteriophage DNA

The bacteriophage DNA was extracted using the QIAprep Spin M13 kit (QIAGEN, Germany) and according to the manufacturer’s instruction. DNA was detected with the Nano drop (Optizen, Korea) and was visualized by agarose gel electrophoresis [21].

Restriction endonuclease enzyme digestion patterns

A (5-10) μl volume of DNA was digested with EcoRI and AccI enzymes according to the manufacturer’s instructions.

Molecular identification of bacteriophage

In an attempt for molecular identification of the three phages, conserved genomic sequences of Staphylococcus aureus phage type 3A, 11, 77, 187 and Twort like phages representing serogroups A, B, F, L and D were used. Each conserved sequence encodes a certain protein such as head protein, major capsid protein, packaging protein, tail protein or tail fiber protein [23]. Taq PCR master mix used and was supplied by Bioneer (Korea); the primers were designed by Macrogen (Korea). The primer sequences and their lengths are shown in Table 1.

Phage type Sero-group Primer Primer sequence (5’-3’) PCR product length (bp) Sequence coding for
3A-like phage A SGA1
SGA2
TATCAGGCGAGAATTAAGGG
CTTTGACATGACATCCGCTTGAC
744 Tail fibers
11-like phage B SGB1
SGB2
ACTTATCCAGGTGGYGTTATTG
TGTATTTAATTTCGCCGTTAGTG
405 Hypothetical tail protein
77-like phage F SGF1
SGF2
CGATGGACGGCTACACAGA
TTGTTCAGAAACTTCCCAACCTG
155 Hypothetical tail protein
  Sub-group Fa SGFa1
SGFa2
TACGGGAAAATATTCGGAAG
ATAATCCGCACCTCATTCCT
548 Packaging protein
  Sub-group Fb SGFb1
SGFb2
AGACACATTAAGTCGCACGATAG
TCTTCTCTGGCACGGTCTCTT
147 Packaging protein
187-like phage L SGL1
SGL2
GCTTAAAACAGTAACGGTGACAGTG
TGCTACATCATCAAGAACACCTGG
648 Hypothetical capsid protein
Twort-like phage D SGD1
SGD2
TGGGCTTCATTCTACGGTGA
GTAATTTAATGAATCCACGAGAT
331 Major capsid protein 

Table 1: Staphylococcal phage type, sero-group, primer sequence, PCR product length (bp) and type of protein.

Detection of possible toxin genes by polymerase chain reaction (PCR)

Undesirable genes including staphylococcal enterotoxins and exfoliating toxins as well as toxic shock syndrome toxin of the isolated phages were searched by using QIAGEN multiplex PCR kit (QIAGEN, Germany) using a thermo cycler from Eppendorf (mastercycler, personal 5332, Germany) and according to the manufacturer’s instructions. The primers were designed for this study by Eurogentec (Belgium). A 100 μM (100 pmol/μl) stock of each primer was prepared according to the technical data sheet for each primer and kept in TE buffer at -70°C. Staphylococcus aureus specific genes, primers and their exact sequence as well as the size of the amplified product (bp) are listed in Table 2 [24].

Gene Primer Oligonucleotide sequence (5’-3’) Size of amplified product (bp)
sea GSEAR-1
GSEAR-2
GGTTATCAATGTGCGGGTGG CGGCACTTTTTTCTCTTCGG 102
seb GSEBR-1
GSEBR-2
GTATGGTGGTGTAACTGAGC CCAAATAGTGACGAGTTAGG 164
sec GSECR-1
GSECR-2
AGATGAAGTAGTTGATGTGTATGG CACACTTTTAGAATCAACCG 451
sed GSEDR-1
GSEDR-2
CCAATAATAGGAGAAAATAAAAG ATTGGTATTTTTTTTCGTTC 278
see GSEER-1
GSEER-2
AGGTTTTTTCACAGGTCATCC CTTTTTTTTCTTCGGTCAATC 209
eta GETAR-1
GETAR-2
GCAGGTGTTGATTTAGCATT AGATGTCCCTATTTTTGCTG 93
etb GETBR-1
GETBR-2
ACAAGCAAAAGAATACAGCG GTTTTTGGCTGCTTCTCTTG 226
tst GTSSTR-1    GTSSTR-2 ACCCCTGTTCCCTTATCATC TTTTCAGTATTTGTAACGCC 326  

Table 2: Staphylococcus aureus specific genes, primers and their exact sequence as well as the predicted size of the amplified product (bp).

Results

Bacteriophage isolation

The isolation of bacteriophage from sewage was successful on the first attempt in October 2014 (Figure 1). Initially 20 phages were isolated and of these about 8 phages were tested for their host range. Out of 8 phages only three bacteriophages (?SA1, ?SA2, and ?SA3) were selected for further characterization for showing a strong lytic activity against all MRSA isolates. The titre of the three bacteriophages (?SA1, ?SA2, and ?SA3) was (5x1012, 2x1011 and 4x1013) respectively. A stock of each of the three bacteriophage sample was prepared and purified. All three phages produced clear large to medium sized plaques (4-6 mm in diameter) when propagated on MRSA isolate.

medical-microbiology-diagnosis-Plaques-caused

Figure 1: Plaques caused by bacteriophage ɸSA1.

Morphology of bacteriophage

The appearance of the three phages by transmission electron microscopy is shown in Figure 2. All three phages have an icosahedral head and a long thin non-contractile flexible tail with tail fibers. Based on their morphology all three phages belong to the family Siphoviridae (order Caudovirales).

medical-microbiology-diagnosis-Electron-microscopy

Figure 2: Electron microscopy images of phages ɸSA 1, ɸSA 2 and ɸSA 3. All phages have long non contractile flexible tails. Bar= 50 nm.

The dimensions of the three phages are shown in Table 3. Five images of each phage were measured and the mean values were recorded. All phages have long non contractile flexible tail ranging from 159 nm to 167 nm in length.

Phage Head dimensions (nm) Tail dimensions (nm)
  Length Width Length Width
ɸSA1 39 37 167 9
ɸSA2 42 39 160 10
ɸSA3 50 52 159 16  

Table 3: Estimated dimensions of phages ɸSA1, ɸSA 2 and ɸSA 3). Each value is the mean of five independent measurements.

Host range

The host range of bacteriophage samples was determined against 100 isolates of methicillin resistant Staphylococcus aureus (MRSA). All three phages showed lytic activity against all 100 MRSA isolates. The characteristic clear zone of inhibition is shown in Figure 3.

medical-microbiology-diagnosis-MRSA-isolate

Figure 3: Spot test of phages (ɸSA1, ɸSA 2 and ɸSA 3) against an MRSA isolate showing a clear zone of inhibition. Co = control with no phage added.

Resistance of bacteriophage to acidity and alkalinity

Differences between the three phages in the pH range in which they were active were observed. All phages were resistant to pH 4 to pH 9. Phages ?SA1 and ?SA2 were also resistant to pH 10 while ?SA3 was resistant to pH 3 (Table 4).

pH range Titre of phages that survived (pfu/ml)
  ɸSA1 ɸSA2 ɸSA3
1 ND* ND ND
2 ND  ND ND
3 2 x 102 1 x 102 3 x 105
4-9 108 108 109
10 1 x 102 2 x 102 3 x 104
11 ND ND 1 x 101
Control 109 109 109

Table 4: Titre of phages (ɸSA1, ɸSA2 and ɸSA3) after exposure to a range of pH from 1 to 11.

Restriction endonuclease enzyme digestion patterns

All three phages were highly refractory to restriction by EcoRI and AccI endonucleases enzymes. No migrating fragments could be detected (data not shown).

Molecular identification of bacteriophage

Based on the multiplex PCR results 4 genes out of 7 were detected The PCR products were 155 bp, 405 bp, 548 bp and 744 bp) (Figure 4). These genes are common among staphylococcal phages of Siphoviridae family sero-groups A, B and F which include mostly temperate phages infecting Staphylococcus aureus.

medical-microbiology-diagnosis-Multiplex-PCR

Figure 4: Multiplex PCR showing the presence of amplicons for gene sequences for 3 proteins common to all three samples and the presence of gene sequences for tail fibers (744 bp) in ɸSA1 and ɸSA3.

Multiplex PCR for detection of possible staphylococcal toxins

The PCR results showed that all three phages do not encode for any of the staphylococcal toxins investigated, which consist of staphylococcal enterotoxins (sea, seb, sec and see), exfoliating toxins (eta and etb) and the toxic shock syndrome toxin (tst) (Figure 5).

medical-microbiology-diagnosis-Multiplex-PCR

Figure 5: Multiplex PCR for detection of genes for staphylococcal toxins: sea (102 bp), seb (164 bp), sec (451 bp), sed (278 bp), see (209 bp), eta (93 bp), etb (226 bp) and tst (326 bp). None of these genes were present. Marker (M) is 10 Kb KAPA Universal Ladder.

Discussion

The aim of the study was to isolate and characterize bacteriophages that have lytic activity against MRSA. Phages are known to be the most abundant viruses in the environment [25]. They are widely spread and can appear in many different environments including marine and soil environments [26,27]. Waste-water treatment plant was considered as a potential source of phages in the current study. The isolation of Siphoviridae phages was successful from the first attempt with high phage titre ≥1010 since these phages are known for their ability to withstand adverse conditions due to their morphology [28,29].

Based on the morphological features of the bacteriophages observed by electron microscopy all three phages belong to the Siphoviridae family with icosahedral head and long non-contractile flexible tail. The name Siphoviridae comes from the Greek word Siphon which means tube referring to the long tail [22]. This family includes eight genera that are characterized by having long (65-570 x 7-10 nm), noncontractile, thin tails which are often flexible and built of stacked disks of 6 subunits [22].

The newly isolated phages are virulent against a broad range of S. aureus isolates while most staphylococcal phages of this family are temperate phages detected as prophage or may have lytic activity due to mutation in the lysogeny functions [30,31]. However there are several Siphoviral phages with lytic activity against a wide range of S. aureus such as YMC/09/04/R1988 MRSA BP [32]. Other virulent phages against MRSA have been isolated such as SEW, M1M4, CJ11, CJ12, CJ16, CJ17, CJ18 and CF6 [33].

The three phages were susceptible to low pH levels of 1 and 2 while their susceptibility to pH 3 varied. Phages are usually influenced by the acidity of the environment but some phages can withstand low pH environment (pH≤3.5) [34]. All three phages were stable within a wide pH range from 4-10 resembling other phages of Siphoviridae family such as the λ phage [35]. ?SA3 was stable at a wider pH range (3-11) while ?SA1 and ?SA2 were stable at pH (4-10). Extremely high pH environments (pH≥12) were unfavourable for all three phages. The ability of these phages of Siphoviridae to survive such a wide range of pH make them suitable for oral administration as possible bacteriophagebased DNA vaccines as suggested by Jepson [35].

Interestingly, all three phages were refractory to digestion by endonuclease enzymes such as EcoRI and AccI. This phenomenon is referred to as an anti-restriction mechanism which is common among Siphoviridae phages [36,37]. There are several anti-restriction strategies by which phages can evade destruction by their bacterial host restriction systems [38]. These anti-restriction strategies include alteration of phage DNA sequence such as the loss of recognition sites in the phage genome for a particular endonuclease enzyme and the incorporation of unusual bases in the phage DNA making it insensitive to digestion by endonuclease enzymes, transient occlusion or blocking of restriction sites by phage encoded proteins, subversion of restriction-modification activities and direct inhibition of restriction enzymes by phage encoded anti-restriction proteins [38-41].

The molecular identification of the three phages showed remarkable results. A high degree of homology between the newly isolated virulent phages and their temperate ancestors was observed in which four genes all of temperate phage origins were detected. Therefore our data suggest that the genomes of these virulent phages have undergone recombination or horizontal gene transfer from a common genetic pool.

Such mosaicism has been reported several times among members of all three tailed phage families. Due to such mosaicism some lytic phages can be derived from temperate phages by rearrangement and deletion of lysogeny modules [42]. A virulent mycobacteriophage D29 appeared to be derived from the temperate phage L5 due to deletion resulting in 80% homology of their nucleotide sequences [43].

Certain staphylococcal phages encode virulence factors such as staphylococcal toxin which include staphylokinase (sak), enterotoxin A (sea), enterotoxin E (see), enterotoxin P (sep), exfoliative toxin A (eta), Panton-Valentine leukocidin (PVL), toxic shock syndrome toxin (tst), the innate immune modulators SCIN and CHIPS [44-46]. These toxins are responsible for a wide range of life threatening illnesses such as scalded-skin syndrome, food poisoning and toxic shock syndrome [44]. Since these toxins are harmful to mammalian cells it is important to ensure that they are not encoded by therapeutic phages. Based on the PCR results, all three phages were unable to encode for enterotoxins (sea, seb, sec and see), exfoliating toxins (eta and etb) and the toxic shock syndrome toxin (tst). The absence of these genes from the phages needs to be ensured by further studies including complete genome sequencing and clinical trials to ensure their safety as an alternative therapeutic agent against MRSA.

In conclusion, the three isolated phages are highly effective against a wide range of methicillin resistant S. aureus isolates and have the ability to survive a pH range from 4-10. Moreover, these phages lacked genes for the staphylococcal enterotoxins although they show some similarity with their ancestors of the Siphoviridae family. The strong lytic activity of these phages against MRSA, the ability to withstand a wide pH range and the absence of toxin encoding genes all indicate that these Siphoviridae phages maybe a possible alternative for antibiotic therapy but further studies are required to assess their activity in clinical trials.

Acknowledgement

We acknowledge with a deep sense of gratitude, the support of the genetic engineering labs of College of Science at Al-Basra University (Iraq) as well as the support of College of Applied Biotechnology of Al-Nahrain University (Iraq), and Khajeh Nasir Toosi University of Technology (Iran) for imaging the bacteriophages. We would also like to express our gratitude to professor Carlton Gyles from University of Guelph, Canada for his valuable advice.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 8718
  • [From(publication date):
    March-2016 - Aug 24, 2017]
  • Breakdown by view type
  • HTML page views : 8492
  • PDF downloads :226

Review summary

  1. Sabriyah
    Posted on Oct 17 2016 at 4:56 pm
    The article narrates the isolation and characterization of bacteriophage against staphlococcus which is methicilin resistant. The three isolated phages were found to be highly effective against a wide range of methicillin resistant S. aureus isolates and have the ability to survive a pH range from 4-10. The information represented in the article will help in the furtherance of clinical research in the field of treatment of the disease.
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords