alexa Macrophage Colony-Stimulating Factor Modulates Matrix Metalloproteinase 2 and 9 Expression in Endometrial Epithelial Cells | OMICS International
ISSN: 2161-0932
Gynecology & Obstetrics
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Macrophage Colony-Stimulating Factor Modulates Matrix Metalloproteinase 2 and 9 Expression in Endometrial Epithelial Cells

Haifaa A Mansouri1*, Nameer B Kirma2, Peter A Binkly2, Naveen K Krishnegowda2 and Rajeshwar R Tekmal2

1Obstetrics and Gynecology Department, King AbdulAziz University Hospital, Saudi Arabia

2Department of Obstetrics and Gynecology, University of Texas Health Science Center at San Antonio, USA

Corresponding Author:
Haifaa A Mansouri
Obstetrics and Gynecology Department
King AbdulAziz University Hospital, Saudi Arabia
Tel: +96626408382
Fax: +96626991443
E-mail: [email protected]

Received Date: March 22, 2014; Accepted Date: May 28, 2014; Published Date: May 31, 2014

Citation: Mansouri HA, Kirma NB, Binkly PA, Krishnegowda NK, Tekmal RR (2014) Macrophage Colony-Stimulating Factor Modulates Matrix Metalloproteinase 2 and 9 Expression in Endometrial Epithelial Cells. Gynecol Obstet (Sunnyvale) 4:223. doi: 10.4172/2161-0932.1000223

Copyright: © 2014 Mansouri HA, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Gynecology & Obstetrics


Objective: To investigate m-Colony Stimulating Factor (CSF-1) effect on the expression of Matrix Metalloproteinases (MMP) 2 &-9 by primary endometrial epithelial cells (EECs) and Endometrial Stromal Cells (ESCs).
Design: In vitro study. Main Outcome measure: the expression of MMP 2 &-9 by EECs and ESCs.
Results: MMP-2 expression and activity of primary epithelial cells significantly decreased in CSF-1 treated EECs compared to control vehicle (P Value<0.02). A non-significant decrease in MMP-9 RNA expression and activity was observed in EECs due to CSF-1 treatment. MMP-9 activity was significantly higher in ESCs than in EECs (P Value<0.004). 26122013.
Conclusion: This study suggests that CSF-1 modulates MMP-2 expression and activity in EECs and may regulate MMP-9 via transcriptional and post-transcriptional mechanisms. Future studies are needed to further address the complex regulation of MMP expression in endometriotic lesions.


Macrophage Colony-stimulating factor (m-CSF); Matrix metalloproteinase (MMP); Endometrial Epithelial cells (EEC); Endometriosis


Establishment of endometriotic lesions requires endometrial cells to adhere and invade the peritoneal mesothelium [1]. Matrix Metalloproteinases (MMPs) which mediate tissue remodeling, may contribute to these pathologic processes by degrading Extracellular Matrix (ECM). MMPs can also affect basic cellular functions (proliferation, differentiation, motility, apoptosis, etc.) by regulating the ECM proteins with which cells interact [2]. The peritoneal microenvironment had been previously suggested to play a critical role for the formation of endometriotic peritoneal lesions [3]. Several studies demonstrated that Macrophage-Colony Stimulating Factor (CSF-1) plays an important role in establishing early endometriotic lesions [4-6]. CSF-1 is secreted by eukaryotic cells including or as well as endometrial cells [7,8]. We have shown previously that CSF-1 exerts a direct effect on enhancing Endometrial Epithelial Cell (EEC) proliferation, attachment to Peritoneal Mesothelial Cells (PMCs), and invasion [5].

Digestion of Extracellular Matrix (ECM) components such as collagen by Matrix Metalloproteinases (MMPs) has been shown to play an important role in the remodeling of the ECM [9,10]. In addition, MMPs may release active growth factors and cytokines from inactive precursors bound to the ECM. The activity of these factors may then contribute to the development of endometriosis [3].

In vitro studies have shown a higher expression of MMPs 1, 2 3, 7, and 9 in ectopic endometrium when compared with eutopic endometriotic lesions of healthy women [11]. Endometrial fragments growing in the peritoneal cavity exhibit high level of MMP-2, which may be responsible for the adhesive growth of endometrial cells [11]. The increase of MMP activity induced by peritoneal cytokines can enhance the invasive potential of the endometriotic lesions. Moreover, suppression of metalloproteinases activity inhibits the formation of ectopic lesions in nude mice [12].

In this study, we examined whether CSF-1 is involved in regulating MMP expression and activity, which would be a possible mechanism for CSF-1 induced invasion by EECs. We have specifically investigated CSF-1 effects on the expression of MMP-2 & -9 by primary EECs and ESCs.

Materials and Methods

Cell culture

Eutopic EECs from proliferative phase endometrium were obtained from an IRB-approved endometriosis tissue repository in the Department of Obstetrics and Gynecology at the University of Texas Health Science Center at San Antonio. Primary EEC’s from the proliferative phase were purified and maintained in culture as described previously EECs were grown in monolayer cultures in an enriched medium containing (volumes per liter of solution) [13].

mCDB 131 (Sigma-Aldrich, St-Louis, MO, USA, 330 ml), Medium 199 (Sigma, 335 ml), Minimal Essential Medium-alpha modification (JRH Biosciences, Lenexa, KS, USA, 222 ml), antibiotics and antimycotics (10 ml), 10 μg/ml insulin (1 ml), D-glucose 0.3 μg/ml (667 μl) and FBS (100 ml). To eliminate the effects of steroid hormones and growth factors present in FBS in the media, cells were washed with phenol red-free Hanks buffer salt solution (Invitrogen) and incubated in phenol red-free RPMI media containing charcoal-stripped (C-S), heat-inactivated (H-I) FBS (10%) for 24-48 h before treatment. CSF-1 was used at a concentration of 10 ng/ml based on our previous studies [14].

The growth media was then replaced with the same (containing 10% C-S, H-I FBS) and treatments added. The cells lysate was used for RNA expression experiments and the cells supernatant was used for Zymography.

RNA expression studies

RNA was isolated using the Biofilin RNeasy plus (Boston, MA, USA with a genomic DNA removal step as per manufacturer’s protocol. Reverse Transcription (RT) was carried out using the Applied Biosystems kit (Foster City, CA, USA). Real-time PCR and subsequent analyses were carried out using Smartmix PCR beads (Cepheid, Sunnyvale, CA, USA) with 0.25% Sybr Green in the Cepheid Smart-Cycler to detect MMP- 2,-9 and the housekeeping gene βactin transcripts. MMP2 Human Forward Primer: TTGACGGTAAGGACGGACTC, (sequences, 5’ to 3’). MMP2 Human Reverse Primer: ACTTGCAGTACTCCCCATCG, MMP9 Human Forward Primer: CTCTGGAGGTTCGACGTG, MMP9 Human Reverse Primer: GTCCACCTGGTTCAACTCAC. All primers were acquired from SIGMA Life Sciences.

Melt curve analysis was performed after each real-time PCR to ascertain PCR product specificity. PCR reactions using MMP-2, MMP- 9 and β-actin primer sets gave unique melt peaks, indicative of discrete amplification products, at 87.7° C, 76.3°C, and 90.2°C, respectively. Relative expression was determined using the formula 2ΔΔct. Real time PCR assays were performed in duplicate and repeated at least three times.


Cell culture supernatants were collected and centrifuged at 800 g for 3 min to remove cells or cell debris. The culture supernatant was used to determine the enzymatic activity of Matrix Metalloproteinase 2 (MMP2) and MMP9 by using SDS-PAGE gelatin zymography as described previously using Novex Zymogram Gels (Invitrogen) [15]. Recombinant MMP2 and MMP9 were purchased from R&D systems and used as positive controls [16].

Gelatin Zymography was performed using the supernatants as described by Kleiner with slight modification [17]. Briefly, the supernatant was mixed with Novex Tris-Glycine SDS Sample Buffer (2x) 56 loading buffer and then electrophoresed (95 V; 120 min in mine) in 10% polyacrylamide containing 0.1% gelatin. The gel was washed in zymogram renaturing buffer (25% (v/v) Triton® X-100 plus deionized water, Novex® zymogram renaturing buffer-X 10 from Invitrogen) (2 hours, at 37°C) and incubated in zymogram developing buffer (50 mM Tris base,40 mM HCl, 200 mM NaCl, 5 mM CaCl2, 0.02 % (w/v) Brij 35) for 30 min and then (overnight, at 37°C). Gel was stained in 0.1% Coomassie blue in 40% ethanol, 10% acetic acid (3 h at room temperature) and repeatedly destained in 10% ethanol, 7.5% acetic acid (30 min, room temperature) until visualizing digested bands in the gelatin matrix. Individual bands were quantitated by scanning densitometry using AlphaImager 2200 [18]. Both RNA expression experiments and the Zymography were repeated twice.

Statistical analysis

Given normal distribution, the data are presented as mean ± standard error of the mean (SEM). Differences between treatments were assessed by one-way ANOVA with Bonferroni correction. P<0.05 was considered statistically significant. We used the Data Add-on package for Microsoft Office EXCEL.


We first examined the expression of MMP-2 and MMP-9 RNA of EEC and ESC cells treated with CSF-1 or vehicle. Little effect was observed for MMP-2 expression in primary EECs due to CSF-1 treatment compared to control vehicle (Figure 1A). MMP-2 activity was also examined by zymography gel electrophoresis. The data in Figure 1B shows a significant decrease of MMP-2 activity due to CSF-1 treatment of EECs compared to controls (P<0.02). MMP-2 expression and activity in ESCs, on the other hand, were only slightly affected by CSF-1 treatment (Figure 1).


Figure 1: CSF-1 decreases MMP2 activity in EECs. A, MMP-2 expression was examined by real-time RT-PCR in EECs and ESCs treated with CSF-1(10 ng/mL). RNA expression was normalized to Actin RNA. B, MMP-2 activity was determined by zymography gel electrophoresis in CSF-1 treated EECs and ESC. C, A representative zymograph is shown for EECs. Digested bands are indicated by arrow

We also examined the expression levels and activity of MMP- 9 in EECs and ESCs after CSF-1 treatment. No change in MMP-9 RNA expression and activity was observed in EECs due to CSF-1 treatment (Figure 2A and B). Although a strong increase in MMP- 9 RNA expression was observed in ESCs, a change in its activity in CSF-1 treated cells was not detected (Figure 2). Comparing MMP-9 activity in EECs and ESCs, we found it to be significantly higher in ESCs (P<0.004).


Figure 2: CSF-1 induces MMP9 RNA but not activity ESCs. A, MMP-9 expression was examined by real-time RT-PCR in EECs and ESCs treated with CSF-1(10 ng/mL). RNA expression was normalized to Actin RNA. B, MMP-9 activity was determined by zymography gel electrophoresis in CSF-1 treated EECs and ESC.

MMP2 activity are demonstrated by Zymography in Figure 1, panel C.


Previously we have shown that CSF has a role in establishing early endometriotic lesions including invasion in a murine model and enhancing invasiveness of endometrial cells [4,5]. Because of the involvement of MMP2 and MMP9 in invasion we examined the possibility that CSF-1 may affect MMP-2 and MMP-9 expression and activity as a way to enhance endometrial cell invasion [19]. Surprisingly, CSF-1 had a significant effect in reducing the activity of MMP-2 and to a lesser extent MMP-9 in EECs. This suggests that EECs may not be a major source for MMP-2 and MMP-9 and that CSF-1 induced invasiveness by EECs may depend on other factors during endometriotic lesion development.

Several factors and mechanisms have been suggested to play a role for endometrial cell invasion and eventual establishment of endometriotic lesions, including PMCs mediated invasion of ESCs, activated macrophages, reciprocal communication between macrophages and ESC, and recently Raf-1 kinase pathway through affecting attachment to PMC & trans-mesothelial invasion by primary EEC and ESC, or through TGFβ induced trans-mesothelial invasion [3,20,21].

While differential expression has been detected for the expression of MMPs in ectopic compared to eutopic endometrial tissue, little has been done to examine MMP activity [11,22]. Nonetheless, these differences suggest that MMP expression may be under different regulatory mechanisms in early stages during establishment of endometriotic lesions compared to later stages of established endometriotic lesions. Our data showing that MMP9 activity did not follow the increase in RNA expression may be explained by earlier studies that MMP9 RNA expression was limited to the menstrual phase but the protein was found throughout the cycle phases [23-28]. This could suggest that post transcriptional or posttranslational processes may be involved in regulating MMP-9 protein and activity levels. Future studies are needed to further examine whether potential perturbation in MMP2 and MMP9 activity are relevant in endometriosis lesion formation.

In summary, our data suggest that CSF-1 modulates MMP-2 expression and to a larger extent activity in EECs. Future studies are needed to further address the regulation of MMPs at different stages of the menstrual cycle and endometriotic lesion formation.


Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

  • 7th International Conference on Clinical and Medical Case Reports June 01-02, 2018 Osaka, Japan Theme: Focusing the breakthroughs of case reports in Clinical & Medical Research
    June 01-02, 2018 Osaka, Japan
  • 7th International Conference and Exhibition on Surgery June 21-23, 2018 Dublin, Ireland Theme: Advancements and Endeavours in the Field of Surgery
    June 21-23, 2018 Dublin, Ireland Dublin, Ireland
  • Annual Congress on Research and Innovations in Medicine July 02-03, 2018 Bangkok, Thailand Theme: Current Research and Innovations in Medicine to Improve Human Health
    July 02-03, 2018 Bangkok, Thailand
  • International Conference on Medical and Health Science August 24-25, 2018 Tokyo, JAPAN Theme: Scrutinize the Modish of Medical and Health Science
    August 24-25, 2018 Tokyo, Japan
  • World Summit on Trauma and Reconstructive Surgery Sep 10-11, 2018 Singapore Theme: Expanding new horizons in Trauma and Surgery
    Sep 10-11, 2018 Singapore City, Singapore
  • 6th American Gynecological Surgery Conference September 28-29, 2018 San Antonio | Texas | USA
    September 28-29, 2018 San Antonio, USA
  • World Congress on Fetal and Maternal Medicine October 15-17, 2018 Osaka, Japan Theme: A New Beginning on Fetal, Maternal & Neonatal Medicine
    October 15-17, 2018 Osaka, Japan
  • International Conference on Reproduction and Fertility October 18-19, 2018 Abu Dhabi, UAE
    October 18-19, 2018 Abu Dhabi, UAE

Article Usage

  • Total views: 12248
  • [From(publication date):
    May-2014 - Apr 22, 2018]
  • Breakdown by view type
  • HTML page views : 8430
  • PDF downloads : 3818

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals


[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version