alexa Molecular Characterization of Trichodermaviride Isolated from Rhizospheric Soils of Uttar Pradesh Based on rDNA Markers and Analysis of Their PCR-ISSR Profiles | Open Access Journals
ISSN-2155-9929
Journal of Molecular Biomarkers & Diagnosis
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Molecular Characterization of Trichodermaviride Isolated from Rhizospheric Soils of Uttar Pradesh Based on rDNA Markers and Analysis of Their PCR-ISSR Profiles

Mohammad Shahid1, Anuradha Singh1*, Mukesh Srivastava1 and Srivastava DK2

1 Biocontrol Laboratory, Department of Plant Pathology, C. S. Azad University of Agriculture & Technology, Kanpur, U.P., India

2 Joint Director, Council of Science & Technology, U.P., Lucknow, India

*Corresponding Author:
Anuradha Singh
Research Associate, CSAUAT
Plant Pathology, Kanpur Nagar
208002, India
T el: 9452647730, 9935240430
E-mail: [email protected]

Received Date: January 24, 2014; Accepted Date: February 19, 2014; Published Date: February 22, 2014

Citation: Shahid M, Singh A, Srivastava M, Srivastava DK (2014) Molecular Characterization of Trichodermaviride Isolated from Rhizospheric Soils of Uttar Pradesh Based on rDNA Markers and Analysis of Their PCR-ISSR Profiles. J Mol Biomark Diagn 5:169. doi:10.4172/2155-9929.1000169

Copyright: © 2014 Shahid M, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Molecular Biomarkers & Diagnosis

Abstract

The objectives of this research were to characterize isolates of Trichoderma collected from rhizospheres of chickpea, pigeonpea and lentil crop from different places of Uttar Pradesh, India, using microsatellite-primed polymerase chain reaction (MP-PCR) and ribosomal DNA (rDNA) sequence analysis and to combine these results with morphological characteristics for classification. Thirty isolates of Trichodermaviride obtained from rhizosphere soil of plantation crops, and agricultural fields of UP region were studied using ISSR and ITS-PCR. The genetic relatedness among thirty isolates of T. viride were analyzed with six microsatellite primers. ISSR profiles showed genetic diversity among the isolates with the formation of eight clusters. Analysis of dendrogram revealed that similarity coefficient ranged from 0.27 to 0.95. ITS-PCR of rDNA region with ITS1 and ITS4 primers produced 600bp products in all isolates. This result indicated the identification patterns of Trichoderma isolates.

Keywords

Trichodermaviride; Genetic diversity; PCR; Molecular marker; Microsattelite

Introduction

Soil microorganisms influence ecosystems by contributing to plant nutrition [1], plant health [2], soil structure [3] and soil fertility [4]. It has been widely recognized, particularly in the last two decades, that majority of harsh environments are inhabited by surprisingly diverse microbial communities. Bacteria, actinomycetes and fungi are three major groups of soilinhabiting microorganisms. An estimated 1,500,000 species of fungi exist in the world [5]. Trichoderma, commonly available in soil and root ecosystems has gained immense importance since last few decades due to its biological control ability against several plant pathogens [6]. Antagonistic microorganisms, such as Trichoderma, reduce growth, survival or infections caused by pathogens by different mechanisms like competition, antibiosis, mycoparasitism, hyphal interactions and enzyme secretion. In addition, the release of biocontrol agents into the environment has created a demand for the development of methods to monitor their presence or absence in soil. Therefore, monitoring population dynamics in soil is of much importance. Previous methods employed to identify strains of Trichoderma spp. in soil samples have included the use of dilution plates on selective media. However, this method does not distinguish between indigenous strains and artificially introduced ones [7]. The Trichoderma isolates were differentiated by mycelia growth rate and colony appearance, as well as microscopic morphological features, including phialides and phialospores [8]. These can also be distinguished by randomly amplified polymorphic DNA (ISSR) - PCR, restriction fragment length polymorphisms in mitochondrial DNA and ribosomal DNA and sequence analysis of ribosomal DNA [9-13]. The use of molecular phylogenetic markers has refined Trichoderma taxonomy significantly, and phylogenetic analysis of the large number of Trichoderma specie is still a field of active ongoing research. Microsatellites, which are also known as short tandem repeats or simple sequence length polymorphisms, are stretches of tandem mono-, di-, tri-, and tetranucleotide repeats of varying lengths Such sequences are widely dispersed in eukaryotic genomes including those of fungi; they are also present but less frequent in prokaryotic genomes.

Materials and Methods

Isolation and identification of Trichoderma

Trichoderma isolates were originally isolated from soil collected from rhizospheres of chickpea, pigeonpea and lentil crop from different places of Uttar Pradesh, India, and Trichodermaisolates were isolated on Potato Dextrose Agar medium by following serial dilution plate technique. They were cultured on PDA 25°C for seven days. After an incubation period, colonies were purified and determined to be Trichoderma species and confirmed using Trichoderma morphological key. The identity of the purified bioagents was then confirmed by ITCC, Division of Plant Pathology IARI, New Delhi-12. Single-spore isolates of 30 Trichoderma isolates were cultured in Erlenmeyer flasks (250 ml) containing 100 ml potato dextrose broth at 25°C for seven days. Mycelia were harvested by filtration through whatman filter paper. Samples were frozen in liquid nitrogen and ground to fine powder using a mortar and pestle.

Genomic DNA extraction from Trichoderma isolates

Isolation of fungal genomic DNA was done by growing the fungi for 3-4 days. The mycelia were incubated with lysis buffer containing 250 mMTris-HCl (pH 8.0), 50 mMEDTA (pH8.0), 100 mMNaCl and 2% SDS, for 1 hr at 60°C followed by centrifugation at 12,000 rpm for 15 min. The supernatant was then extracted with equal volume of water saturated phenol and further centrifuged at 12,000 rpm for 10 min; the aqueous phase was further extracted with equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) and centrifuge at 12,000 rpm for15 min; the aqueous phase was then transferred in a fresh tube and the DNA was precipitated with chilled ehanol (100%). DNA was pelleted by centrifuging at 12000 rpm for 15 min and washed in 70% ethanol by centrifugation. The pellets were air dried and suspended in TE buffer (Tris EDTA buffer) (pH 8.0).

Qualitative and quantitative estimation of DNA

The extraction of total genomic DNA from the Trichodrma isolates as per the above procedure was followed by RNAase treatment. Genomic DNA was re suspended in 100 μl 1 X TE buffer and incubated at 37°C for 30 min with RNAse (60 μg). After incubation the sample was re extracted with PCI (Phenol: Chloroform: Isoamylalcohol 25:24:1) solution and RNA free DNA was precipitated with chilled ethanol as described earlier. The quality and quantity of DNA was analyzed both All isolates of Trichoderma were taken up for ITS-PCR spectrophotometrically and in 0.8% agarose gel. The DNA from all isolates produced clear sharp bands, indicating good quality of DNA.

PCRamplification of its region of Trichoderma isolates

Amplification Genomic DNA was amplified by mixing thetemplate DNA (50 ng), with the polymerase reaction buffer, dNTP mix, primers and Taq polymerase. Polymerase Chain Reaction was performed in a total volume of 100 μl, containing 78 μl deionized water, 10 μl 10 X Taq pol buffer, 1 μl of 1 U Taq polymerase enzyme, 6 μl 2 mMdNTPs, 1.5 μl of 100 mM reverse and forward primers and 1 μl of 50 ng template DNA. PCR was programmed with an initial denaturing at 94°C for 5 min. followed by 30 cycles of denaturation at 94°C for 30 sec, annealing at 59°C for 30 sec and extension at 70°C for 2 min and the final extension at 72°C for 7 min ina Primus 96 advanced gradient Thermocycler. PCR product (20 μl) was mixed with loading buffer (8 μ1) containing 0.25% bromophenol blue, 40% w/v sucrose in water and then loaded in 2% Agarose gel with 0.1% ethidium bromide for examination with horizontal electrophoresis.

ISSR of Trichoderma isolates

For ISSR, six microsatellite primers i.e. A-1; A-2; A-3; A-4; A-5 and A-6 were selected (Table 1). PCR was programmed with an initial denaturing at 94°C for 4 min. followed by 35cycles of denaturation at 94°C for 1 min, annealing at 36°C for 1 min and extension at 70°C for 90 s and the final extension at 72°C for 7 min in a Primus 96 advanced gradient Thermocycler. PCR product (20 μl) was mixed with loading buffer (8 μ1) containing 0.25% bromophenolblue, 40% w/v sucrose in water and then loaded in 2%Agarose gel with 0.1% ethidium bromide for examination by horizontal electrophoresis [14].

Priner Name Sequence( 5’-3’) Mer TM % GC
ITS-Primers pairs        
T/ITS 1 TCTGTAGGTGAACCTGCGG 19 63.9 57
T/ITS4 TCCTCCGCTTATTGATATGC 20 61.5 45
ISSR primers        
A-1 5’YC (TG)7T3’ 17 49.77 47
A -2 5’(GA)9AC3’ 20 53.70 55
A-3 5’(GA)9T3’ 20 58.01 47
A-4 5’(GA)8AC3’ 18 56.35 40
A-5 5’(AG)8AC3’ 18 60.17 50
A-6 5’(AG)8AT3’ 18 60.26 47

Table 1: The nucleotide sequence used for ITS and Trichoderma PCR.

Scoring and data analysis

The image of the gel electrophoresis was documented through Bio-Profil Bio-1D gel documentation system and analysis software. All reproducible polymorphic bands were scored and analysed following UPGMA cluster analysis protocol and computed In Silico into similarity matrix using NTSYSpc (Numerical Taxonomy System Biostastiscs, version 2.11W) [15]. The SIMQUAL program was used to calculate the Jaccard’s coefficients. The ISSR patterns of each isolate was evaluated, assigning character state “1” to indicate the presence of band in the gel and “0” for its absence in the gel. Thus a data matrix was created which was used to calculate the Jaccard similarity coefficient for each pair wise comparison. Jaccard coefficients were clustered to generate dendograms using the SHAN clustering programme, selecting the Unweighted Pair-Group Methods with Arithmetic Average (UPGMA) algorithm in NTSYSpc.

Results and Discussion

Thirty isolates were obtained using the Trichoderma selective medium from the rhizospheres soil (Table 2). The ribosomal RNA genes (rDNA) possess characteristics that are suitable for the identification of fungal isolates at the species level. These rDNA are highly stable and exhibit a mosaic of conserved and diverse regions within the genome [16]. They also occur in multiple copies with up to 200 copies per haploid genome [17,18] arranged in tandem repeats with each repeat consisting of the 18S small subunit (SSU), the 5.8S and the 28S large subunit (LSU) genes. Internal Transcribed Spacer (ITS) regions have been used successfully to generate specific primers capable of differentiating closely related fungal species [19]. In the broader context, taxon-selective amplification of IT Sregions is likely to become a common approach in molecular identification strategies, In the present study, we focused on the ITS regions of ribosomal genes for the construction of primers that can be used to identify Trichoderma spp. ITS region of rDNA was amplified using genus specific ITS-1 and ITS4 primers amplified the primers (Figure 1-3). The results are in accordance with variability of the Trichoderma isolates. These results are also in accordance with several workers who observed the amplified rDNA fragment of approximately 500 to 600 bp by ITS-PCR in Trichoderma [20-24]. The ITS PCR has helped to detect polymorphism at ITS region of rDNA among the Trichoderma isolates. Products of size in the range of 600bp was produced by Mukherjee [20] who studied the identification and the genetic relatedness among thirty isolates of Trichodermaviride and were analyzed by six microsattelite primers A-1; A-2; A-3; A-4; A-5 and A-6 to generate reproducible polymorphisms. All amplified products with the primers had shown polymorphic and distinguishable banding patterns which indicate the genetic diversity of Trichoderma isolates. A total of 53 reproducible and scorable polymorphic bands ranging from approximately 100bp to 2000bp were generated with six primers among the thirty Trichoderma isolates (Table 3). ISSR profiles showed that primer A-1 and A4 scored highest bands which ranged between 100bp to 2000bp. Relationships among the isolates was evaluated by cluster analysis of the data based on the similarity matrix. The Dendogram was generated by unweighted pair-group methods with arithmetic mean (UPGMA) using NTSYSpc software (Figure 4). Based on the results obtained all the thirty isolates can be grouped into two main clusters. One cluster represents T.viride. Again the T. viride cluster is also sub grouped into two. First subgroup with 18 isolates and second one is with 12 isolates of two sub clusters. The cluster of T. viride divided into two different cluster contains different isolates.

molecular-biomarkers-diagnosis-amplification

Figure 1: PCR amplification of ITS region of Trichoderma isolates. T. viride (Lane 1-30) Lane M: Low range DNA Marker, Lane 1- ITCC-8305/11, Lane2- ITCC-8306/11, Lane3- ITCC-8307/11, Lane4- ITCC-8308/11, Lane5- ITCC- 8309/11, Lane6- ITCC-8310/11, Lane7- ITCC-8311/11, Lane8- ITCC-8312/11, Lane9- ITCC-8313/11, Lane10- ITCC-8314/11, Lane11- ITCC-8315/11, Lane12- ITCC-8316/11, Lane13- ITCC-8317/11, Lane14- ITCC-8318/11, Lane15- ITCC-8319/11, Lane16- ITCC-8320/11, Lane17- ITCC-8321/11, Lane18- ITCC-8322/11, Lan19- ITCC-8323/11, Lan20- ITCC-8324/11, Lane 21- ITCC-8325/11, Lane 22- ITCC-8326/11, Lane 23- ITCC-8327/11, Lane24- ITCC-8328/11, Lane 25 - ITCC-8329/11, Lane 26 - ITCC-8330/11, Lane 27 - ITCC-8331/11, Lane 28- ITCC-8332/11, Lane 29 - ITCC-8333/11 and Lane 30 - ITCC-8334/11.

molecular-biomarkers-diagnosis-Kilobasepair

Figure 2: PCR amplification of ISSR (A1 marker) of Trichoderma isolates. T. viride (Lane 1-30) Lane M: Low range DNA (1 Kilobasepair) Marker, Lane 1- ITCC-8305/11, Lane2- ITCC-8306/11, Lane3- ITCC-8307/11, Lane4- ITCC- 8308/11, Lane5- ITCC-8309/11, Lane6- ITCC-8310/11, Lane7- ITCC-8311/11, Lane8- ITCC-8312/11, Lane9- ITCC-8313/11, Lane10- ITCC-8314/11, Lane11- ITCC-8315/11, Lane12- ITCC-8316/11, Lane13- ITCC-8317/11, Lane14- ITCC-8318/11, Lane15- ITCC-8319/11, Lane16- ITCC-8320/11, Lane17- ITCC-8321/11, Lane18- ITCC-8322/11, Lan19- ITCC-8323/11, Lan20- ITCC-8324/11, Lane 21- ITCC-8325/11, Lane 22- ITCC-8326/11, Lane 23- ITCC-8327/11, Lane24- ITCC-8328/11, Lane 25 - ITCC-8329/11, Lane 26 - ITCC-8330/11, Lane 27 - ITCC-8331/11, Lane 28- ITCC-8332/11, Lane 29 - ITCC-8333/11 and Lane 30 - ITCC-8334/11.

molecular-biomarkers-diagnosis-Marker

Figure 3: PCR amplification of ISSR (A4 marker) of Trichoderma isolates. T. viride (Lane 1-30) Lane M: Low range DNA (1 Kilobasepair) Marker, Lane 1- ITCC-8305/11, Lane2- ITCC-8306/11, Lane3- ITCC-8307/11, Lane4- ITCC- 8308/11, Lane5- ITCC-8309/11, Lane6- ITCC-8310/11, Lane7- ITCC-8311/11, Lane8- ITCC-8312/11, Lane9- ITCC-8313/11, Lane10- ITCC-8314/11, Lane11- ITCC-8315/11, Lane12- ITCC-8316/11, Lane13- ITCC-8317/11, Lane14- ITCC-8318/11, Lane15- ITCC-8319/11, Lane16- ITCC-8320/11, Lane17- ITCC-8321/11, Lane18- ITCC-8322/11, Lan19- ITCC-8323/11, Lan20- ITCC-8324/11, Lane 21- ITCC-8325/11, Lane 22- ITCC-8326/11, Lane 23- ITCC-8327/11, Lane24- ITCC-8328/11, Lane 25 - ITCC-8329/11, Lane 26 - ITCC-8330/11, Lane 27 - ITCC-8331/11, Lane 28- ITCC-8332/11, Lane 29 - ITCC-8333/11 and Lane 30 - ITCC-8334/11.

molecular-biomarkers-diagnosis-Dendrogram

Figure 4: Dendrogram showing the genetic relationships among 30 Trichoderma fungal isolates based on ISSR analysis.

ITCC No. IARI, New Delhi Culture No Ref. No. Source Fungus identified
ITCC-8305/11 8 CP 1 Kanpur Nagar Trichoderma viride
ITCC-8306/11 11 CP 2 Allahabad Trichoderma viride
ITCC-8307/11 17 CP 3 Kaushambi Trichoderma viride
ITCC-8308/11 33 CP 4 Sitapur Trichoderma viride
ITCC-8309/11 34 CP 5 Hardoi Trichoderma viride
ITCC-8310/11 35 CP 6 Fatehpur Trichoderma viride
ITCC-8311/11 66 CP 7 Auraiya Trichoderma viride
ITCC-8312/11 89 CP 8 Unnao Trichoderma viride
ITCC-8313/11 102 CP 9 Etawah Trichoderma viride
ITCC-8314/11 119 CP 10 Kanpur Dehat Trichoderma viride
ITCC-8315/11 01 PP 11 Hardoi Trichoderma viride
ITCC-8316/11 09 PP 12 Kanpur Nagar Trichoderma viride
ITCC-8317/11 14 PP 13 Barabanki Trichoderma viride
ITCC-8318/11 17 PP 14 Fatehpur Trichoderma viride
ITCC-8319/11 29 PP 15 Unnao Trichoderma viride
ITCC-8320/11 42 PP 16 Bahrich Trichoderma viride
ITCC-8321/11 67 PP 17 Auraiya Trichoderma viride
ITCC-8322/11 74 PP 18 Sitapur Trichoderma viride
ITCC-8323/11 78 PP 19 Etawah Trichoderma viride
ITCC-8324/11 124 PP 20 Kanpur Dehat Trichoderma viride
ITCC-8325/11 13 L 21 Kanpur Nagar Trichoderma viride
ITCC-8326/11 35 L 22 Sitapur Trichoderma viride
ITCC-8327/11 68 L 23 Hardoi Trichoderma viride
ITCC-8328/11 74 L 24 Auriaya Trichoderma viride
ITCC-8329/11 89 L 25 Gonda Trichoderma viride
ITCC-8330/11 100 L 26 Faizabad Trichoderma viride
ITCC-8331/11 104 L 27 Etawah Trichoderma viride
ITCC-8332/11 109 L 28 Allahabad Trichoderma viride
ITCC-8333/11 117 L 29 Sultanpur Trichoderma viride
ITCC-8334/11 119 L 30 Kanpur Dehat Trichoderma viride

Table 2: Isolates of Trichoderma spp.

Sl.No. Primers Total loci Polymorphic loci Polymorphic %age
A-1 5’YC (TG)7T3’ 6 6 100
A -2 5’(GA)9AC3’ 9 7 77
A-3 5’(GA)9T3’ 9 5 55
A-4 5’(GA)8AC3’ 9 9 100
A-5 5’(AG)8AC3’ 10 6 60
A-6 5’(AG)8AT3’ 10 8 80
Total   53 41 77

Table 3: Analysis of the polymorphism obtained with ISSR markers in 30 Trichoderma isolates.

Conclusion

Preliminary studies indicates that the Trichoderma isolates had very good diversity and there are strong possibility to get the isolate specific primers that will be utilized for identifying the particular Trichoderma isolates with good biological potential from the field isolates without going the cumbersome bioassay again.

Acknowledgements

The authors are grateful for the financial support granted by the Indian Council of Agriculture Research (ICAR) Govt. of India under the Niche Area of Excellence on “Exploration and Exploitation of Trichoderma as an antagonist against soil borne pathogens” running in the Biocontrol Laboratory, Department of Plant Pathology, C.S.A. University of Agriculture and Technology, Kanpur, India.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Article Usage

  • Total views: 11541
  • [From(publication date):
    March-2014 - Oct 21, 2017]
  • Breakdown by view type
  • HTML page views : 7769
  • PDF downloads :3772
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords