alexa Molecular Detection of Enterotoxin B from <em>Staphylococcus aureus</em> | OMICS International
ISSN 2576-389X
Journal of Infectious Diseases and Diagnosis
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Molecular Detection of Enterotoxin B from Staphylococcus aureus

Sheikhi F, Zeinoddini M*, Saeedinia AR, Rouhani Nejad H and Monazah A

Department of Bioscience and Biotechnology, Malek Ashtar University of Technology, Tehran, Iran

*Corresponding Author:
Zeinoddini M
Department of Bioscience and Biotechnology
Malek Ashtar University of Technology, Tehran, Iran
Tel: +982122974600
E-mail: [email protected]

Received date: August 03, 2017; Accepted date: August 28, 2017; Published date: September 26, 2017

Citation: Sheikhi F, Zeinoddini M, Saeedinia AR, Rouhani NH, Monazah A (2017) Molecular Detection of Enterotoxin B from Staphylococcus aureus. J Infect Dis Diagn 2:117.

Copyright: © 2017 Sheikhi F, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Infectious Diseases and Diagnosis

Abstract

Background: Food poisoning due to the bacteria is a big global problem in economically and human's health. This problem refers to an illness which is due to infection or the toxin exists in nature and the food that we use. One of the most important productive factors is Staphylococcus aureus. In general different strain of S. aureus produces several enterotoxins like: SEA, SEB, SEC. So, the existence of S. aureus in foods is a potential risk, especially if the foods are not storage in proper temperature. In this work, by designing of new primer the enterotoxin B (SEB) has been detected using PCR techniques.

Material and method: In this study, the primer explorer V4 software was used for designing specific primers. The extracted DNA genomic from S. aureus was using for PCR reaction. The PCR product analysed by agarose gel (1.2%) electrophoresis. Also specificity of this method was determined using different strains of S. aureus A (SEA), S. aureus C (SEC) and Vibrio cholera O1. Also, sensitivity was distinguished by serial dilution of S. aureus DNA genomic.

Results and conclusion: PCR assay showed a 226 bp specific amplified fragment. The sensitivity of this method determined about 200 CFU/ml and also the results showed that according to specific primers, the PCR is very specific. Therefore, this procedure is very sensitive and rapid technique for SEB detection of S. aureus. In conclusion, this PCR assay can be used like a simple diagnostic test in clinical laboratories for identification of foodborne disease.

Keywords

Staphylococcus aureus, Enterotoxins B, PCR, Food poisoning

Introduction

Food safety and food-borne diseases have attracted extensive attention in the world, and lack of preventative control would causes contamination in the food storage processing and marketing [1,2]. Important factors that might lead to food poisoning consist of 5 categories: uncertain food sources, not enough cooking, improper storage temperature, the polluted equipment and poor personal hygiene. Therefore, the especial anxiety which exist due to the danger of foods mostly includes: microbiology, chemical, remains of pesticide, remains of veterinary medicines and allergic compounds. Food-borne diseases due to the bacteria are a big global problem in 2 aspects: economically and human's health [3,4]. The most important bacteria which cause food pollution and therefore result in food poisoning includes: Escherichia coli, Shigella spp, Salmonella spp, Bacillus cereus, Listeria monocytogenes, Enterococcus faecalis, Staphylococcus aureus and Vibrio cholera [5,6]. S. aureus as one of the most reasons of illness and mortality in less developed countries is the most common and significant pathogen in both healthy and immune-deficient individuals [7,8]. Accordingly, correct and rapid detection of this bacteria and pyrogenic exotoxins, such as Staphylococcal Enterotoxins (SE) is very important. SE is critical factor for food poisonous that produced by some S. aureus strains [9,10]. Almost all of the SEs is heat-stable proteins which after ingestion and inhalation to cause gastroenteric syndrome in humans. From 18 SEs that discovery, only a few SEs play a role in food poisoning [11]. The two critical SEs that induce food poisonous are SEA and SEB [12-14]. On the other hand, traditional detection methods for infection pathogens in clinical laboratories is biochemical techniques and microscopic observation according to enrichment culture which is currently time consuming, laborious and the difficult of quantitative assessment [15,16]. Therefore, for simple and correct detection of several pathogens, we need to a rapid identification assay of food-borne bacterial pathogens using genome-based amplification. For this, molecular detection method such as PCR and Real-Time PCR is recommended for identification of SEB in food material. In this work, we design a new primer for detection of the enterotoxin B (SEB) using PCR techniques.

Material and Methods

Bacterial culture and DNA extraction

At first, S. aureus was cultured in (TSB medium) and incubated for overnight in a shaker incubator for 37°C. Then, the bacterial cells were harvested by centrifuge at 5000 g for 5 min. The genomic DNA was extracted using Sina Clone Kit (Iranian Company) and finally, the extracted DNA analysed by agarose gel 1.2%.

Primer design

New primers were designed according to the sequence of the enterotoxin B gene (Accession No. KX168628.1). These special primers (Forward primer: GTTCGGGTATTTGAAGATGG and revers primer: CAAATTTATCTCCTGGTGCA) are capable of replicating a 226 bp segment from SEB gene.

PCR reaction

The PCR reaction was performed using specific primers. Mixed PCR was prepared in a volume of 5 µl, containing 57 ng DNA, 1 µM of each primer, and master mix of Taq DNA polymerase (amplicon PCR kit, Denmark). The PCR program included: Initial denaturation at 95°C for 10 min, 35 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 10 min. Results were analysed by 1.2% agarose gel.

Sensitivity and specificity

In order to measure the sensitivity of primers, serial dilution of genomic DNA were prepared and used as a template. To evaluate the specificity of primers, a variety of bacteria including S. aureus A (SEA), S. aureus C (SEC), Vibrio cholera O1, were used. The results were analysed by 1.2% agarose gel..

Results

DNA amplification

DNA was extracted from S. aureus B (SEB). The results were analysed by 1.2% agarose gel (Figure 1A). Extracted DNA was used for PCR as template. PCR reaction with pre-prepared primers was then performed according to materials and methods. Amplification of 226 bp fragment confirmed the susceptibility of this assay (Figure 1B).

infectious-diseases-diagnosis-Agarose-gel

Figure 1: (A) Agarose gel electrophoresis of extracted DNA. (B) PCR product using 1.2% agarose gel electrophoresis. Lane 1, SEB gene. Lane 2, negative control. M 100 bp DNA ladder.

Sensitivity and specificity

Serial dilution of Staphylococcal DNA genomic was done from 2 × 108 cfu/ml to 2 × 10-2 cfu/ml and was used as a template. PCR products analysis, showed amplification of 226 bp is performed until 200 cfu/ml (Figure 2A). For specificity examination PCR reaction was done for SEA, SEB and SEC genes, Vibrio cholera O1 genome. The results showed primers very specific and were only amplified SEB genes (226 bp) (Figure 2B).

infectious-diseases-diagnosis-DNA-ladder

Figure 2: (A) Sensitivity of PCR was determined by DNA serial dilutions 2 × 108 (1), 2 × 107 (2), 2 × 106 (3) 2 × 105 (4), 2 × 104 (5), 2 × 103 (6), 2 × 102 (7), 2 × 101 (8), 2 (9), 2 × 10-1 (10), 2 × 10-2 (11) CFU/ml. Lanes 12 and 13 is negative control and M, 100 bp DNA ladder. (B) Specificity of PCR was determined using SEA (1), SEB (2), SEC (3), Vibrio cholera O1 (4), negative control (5) and M 100 bp DNA ladder.

Discussion

S. aureus is the most agents for bacterial foodborne diseases that are one of the biggest problems in human health and food safety according to production and secretion of different Staphylococcal Exotoxins (SEs) [7-10]. Therefore, detection and identification of SEs is very important in order to inhibition and control of food poisoning. There are several methods for detection of entrotoxigenic S. aureus. Animal and serological test is the conventional SEs detection techniques that are labor-intensive and not the possibility of real-time detection. For this, DNA-based molecular assay such as PCR is a rapid, correct and reliable method with sure results that could be detected SEs genome directly [16-19]. PCR-based detection is simple, inexpensive, sensitive and selective which can even detect each bacterium without genome extraction [20]. In previous investigation, detection of S. aureus was carried out using PCR with different rate of sensitivity. In 1992 Brakstad used from PCR for amplification of nuc gene with the detection limit of 103 CFU [21]. Sowmya in 2012 compared PCR and LAMP method for S. aureus detection that sensitivity of PCR reported about 104 CFU/ml [22]. Cremonesi in 2007 developed detection for enterotoxigenic S. aureus that isolates from raw milk and achieved to a detection limit about 100 CFU/g [23]. In this study we designed new primers for the detection of S. aureus SEB genes using PCR technique and the specificity and sensitivity of this assay is determined. The result was shown, the sensitivity of this method is about 200 CFU/ml and it was also found that designed primers are highly specific. In conclusion this simple detection could be used for design and development of molecular kit for identification of S. aureus.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 319
  • [From(publication date):
    September-2017 - Feb 18, 2018]
  • Breakdown by view type
  • HTML page views : 281
  • PDF downloads : 38
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version