alexa Molecular Detection of Panton-Valentine Leukocidin (PVL) Toxins in Clinical Isolates of Staphylococcus aureus from Maitama District Hospital, Abuja, Nigeria | Open Access Journals
ISSN: 2161-0703
Journal of Medical Microbiology & Diagnosis
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Molecular Detection of Panton-Valentine Leukocidin (PVL) Toxins in Clinical Isolates of Staphylococcus aureus from Maitama District Hospital, Abuja, Nigeria

Orji OL1, Olayinka BO1, Afolabi B2, Ejikeugwu Chika P3*, Nwakaeze EA3, Eze CJ3, Eluu SC4 and Agbom C3

1Department of Pharmaceutics and Pharmaceutical Microbiology, Ahmadu Bello University, Zaria, Kaduna state, Nigeria

2Department of Chemical Science, Fountain University, Oke-osun, Oshogbo, Osun State, Nigeria

3Department of Applied Microbiology, Faculty of Sciences, Ebonyi State University, Abakaliki, P.M.B 053, Ebonyi State, Nigeria

4Department of Biological Sciences (Biotechnology Option), Faculty of Sciences, Ebonyi State University, Abakaliki, P.M.B 053, Ebonyi State, Nigeria

*Corresponding Author:
Ejikeugwu Chika P
Department of Applied Microbiology
Faculty of Science, Ebonyi State University
P.M.B. 053, Abakaliki
Ebonyi State, Nigeria
Tel: 2348097684562
E-mail: [email protected]

Received date: July 04, 2016; Accepted date: August 09, 2016; Published date: August 17, 2016

Citation: Orji OL, Olayinka BO, Afolabi B, Ejikeugwu Chika P, Nwakaeze EA, et al. (2016) Molecular Detection of Panton-Valentine Leukocidin (PVL) Toxins in Clinical Isolates of Staphylococcus aureus from Maitama District Hospital, Abuja, Nigeria. J Med Microb Diagn 5: 240. doi:10.4172/2161-0703.1000240

Copyright: © 2016 Chika EP, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Medical Microbiology & Diagnosis

Abstract

Pathogenic Staphylococcus aureus is the most frequently isolated Gram positive bacterium from clinical specimens; and it is among the leading cause of infection in man. S. aureus has gained significant interest in recent years as an important nosocomial pathogen – owing to its multidrug resistant nature which is associated to several virulence factors of the organism including Panton-valentine leukocidin (PVL). PVL is part of the toxins produced by pathogenic S. aureus – which help the organism to exacerbate their pathogenicity/virulence in the phase of an infection. This study evaluated the prevalence of PVL-positive S. aureus from clinical specimens – owing to the dearth of information on this subject matter in Nigeria. Out of the 118 non-consecutive S. aureus isolates employed for this study, only 56 isolates were biochemically confirmed as pathogenic S. aureus. The antibiogram showed that the S. aureus isolates were most susceptible to gentamicin, vancomycin, ciprofloxacin, erythromycin and linezolid. However, they were highly resistant to the cephamycin, cefoxitin (82.1%). The S. aureus isolates also showed reduced susceptibility to tigecycline (71.4%), clindamycin (66.1%), chloramphenicol (48.2%), amoxicillin-clavulanic acid (53.6%) and sulphamethoxazole-trimethoprim (48.2%). The prevalence of PVL genes in this study was 10.7%. Only 6 isolates of S. aureus (10.7%) were confirmed by PCR to harbour the PVL genes; and these S. aureus isolates were from wound samples, abscess and urine samples. The occurrence of pathogenic S. aureus harbouring drug resistant genes such as PVL genes in the hospital environment pose serious health and therapeutic challenges especially in choosing antimicrobial therapy for treatment. S. aureus isolates with PVL genes could also disseminate with high propensity within the hospital environment; and this could result in the outbreak of nosocomial infections. Continues antibiotic stewardship in our hospitals will help in the control and prevention of the emergence and dissemination of drug-resistant microbes in both the community and hospital environment.

Keywords

Panton-Valentine Leukocidin (PVL); Staphylococcus aureus ; Nosocomial infections; Resistance; Antibiotics; Nigeria

Introduction

Staphylococcus aureus is a non-sporulating, nonmotile Gram positive opportunistic pathogen that is usually carried asymptomatically on the body of humans and animals, and they cause a plethora of pathological/disease conditions in humans including skin infections, meningitis, pneumonia, arthritis, endocarditis and osteomyelitis. Pathogenic Staphylococcus aureus still remains an important nosocomial and community-acquired pathogen because of its multidrug resistant nature and its association in several clinical episodes including skin infections and blood-borne infections [1,2]. Staphylococcus aureus has evolved from a once susceptible pathogen to becoming a multidrug resistant organism; and some strains of S. aureus including methicillin resistant S. aureus (MRSA) and vancomycin resistant S. aureus (VRSA) now occur in the community and hospital environments [3,4]. Antibiotic-resistant bacteria pathogens cause serious therapeutic challenge to physicians, patients and other healthcare providers, and the continued intense and misuse of antibiotics (for both clinical and non-clinical purposes) are undoubtedly amongst the many reasons for their emergence and spread in the community and hospital environment [5-7]. Staphylococcus aureus (which is notorious in evolving resistance to β- lactam drugs) accounts for many hospital- and community-acquired infections including skin infections, bacteraemia, and pneumonia, and some strains of S. aureus are resistant to penicillins and some β- lactams. Both hospital acquired and community-acquired stains of pathogenic S. aureus produce different toxins that help to exacerbate their pathogenicity/virulence in the phase of an infection e.g. Panton- Valentine leukocidin (PVL), and Toxic-shock-syndrome-toxin-1 (TSST-1) [4,8-10]. The presence of PVL has been extensively described for methicillin-resistant S. aureus (MRSA), specifically in association with staphylococcal cassette chromosome mec (SCCmec) type IV and also SCCmec type V genes – upon which mecA genes (responsible for ) are found [6,11,12]. According to Amini et al., there are five (5) types of SCCmec genes – which are Types I, II and III (found in hospital-associated MRSA strains) and Types IV and V (which are mostly found in community-acquired MRSA strains). Nevertheless, some reports are of the view that there are eight types of SCCmec genes (Types I-VIII). The emergence and spread of antibiotic resistant strains of pathogenic S. aureus especially those harbouring PVL toxins should be kept under check through accurate and prompt monitoring, evaluation, and detection of resistant pathogenic strains of S. aureus from suspect specimens in both the community and hospital environment. This study evaluated the occurrence of pathogenic S. aureus harbouring Panton valentine leukocidin (PVL) toxins from clinical samples.

Materials and Methods

Collection of isolates

A total of 78 non-duplicate Staphylococcus aureus strains were obtained from the culture collection unit of the Medical Microbiology laboratory of Maitama District Hospital in Federal Capital Territory (FCT), Abuja, Nigeria. The isolates were collected over a period of six (6) months (November 2014 to April 2015), and transported to the laboratory of Department of Pharmaceutics and Pharmaceutical Microbiology, Ahmadu Bello University, Zaria, Kaduna state, Nigeria for further processing.

Purification and re-identification of isolates

To purify the S. aureus isolates, each of the collected isolates was inoculated on nutrient broth overnight at 37oC overnight; and a loopful of the turbid culture was streaked on Nutrient agar plates (Oxoid, UK) and incubated at 37oC for 18-24 hrs. Identification of the bacterial isolates was carried out using standard microbiological procedures as was previously described including catalase test, coagulase, Gram staining, colony morphology and fermentation of mannitol [13,14].

Antibiogram

Antibiotic susceptibility testing was determined by the Kirby-Bauer disk diffusion method as per the Clinical Laboratory Standard Institute (CLSI) criteria using single antibiotic disks including gentamicin (10 μg), ciprofloxacin (5 μg), cefoxitin (30 μg), vancomycin (30 μg), erythromycin (15 μg), tigecycline (15 μg), clindamycin (2 μg), Sulphamethoxazole- trimethoprim (25 μg), chloramphenicol (30 μg), linezolid (10 μg), amoxicillin/clavulanic acid (20/10 μg). Briefly, an overnight culture of the test isolates (adjusted to 0.5 McFarland turbidity standards) was aseptically swabbed on Mueller-Hinton (MH) agar plates (Oxoid, UK), and single antibiotics disks were aseptically placed on each of the plates. The sensitivity plates were then allowed again to stay for 30 minutes for pre-diffusion time before they were incubated at 37oC for 18-24 hours. All the plates were examined for zones of inhibition and the isolates were classified as “resistant”, ”intermediate”, and “sensitive” based on the standard antibiotic breakpoints of CLSI [12,15].

PCR detection of PVL genes

The details of the primer sequences and other thermal cycler PCR conditions are summarized in Table 1. The PCR reaction mixture was made up to 12.5 μl, and this contained 1.0 μl of each primer (100 pmol; PROMEGA, USA), 2.5 U Taq polymerase, 2.5 mM Mg2+, and 2.5 μl PCR buffer. Finally, 4 μl template DNA preparations were added to the PCR reaction mixture. The PCR programme included an initial denaturation step at 94°C for 3 min, followed by 30 cycles of 94°C for 30 sec; annealing step at 56°C for 30 sec and extension step at 72°C for 1 min. A final extension step was done at 72°C for 5 min. The PCR reaction mixture was subjected to thermal cycling; and the PCR products were determined by agarose gel electrophoresis technique (using 1.5% agarose gel with Tris-acetate buffer, TAE, at a volume of 4.0 mmol/l Tris, 1 mmol/EDTA, and pH 8.0), and this was run at a voltage of 160V for 40 mins. The PCR products were visualized under UV light in the presence of ethidium bromide solution [9,12,16].

Gene Primer sequence Amplicon size (bp) Reference
LukS-PVL –F 5ꞌCATGCCATGGATAACAATATTGAGAAT 3ꞌ 500 Lina et al. (1999)
LukS-PVL ­–R 5ꞌCCGCTCGAGTCAATTATGTCCTTTCA3ꞌ    
LukF-PVL –F 5ꞌCATGCCATGGCTCAACATATCACAC3ꞌ 936 Lina et al. (1999)
LukF-PVL –R 5ꞌCCGCTCGAGTTAGCTCATAGGATTTTTTTCC3ꞌ    

Table 1: Oligonucleotide primer sequences and PCR conditions used for detection of PVL genes.

Results

This study evaluated the occurrence of Panton-Valentine Leukocidin (PVL) toxin in clinical isolates of Staphylococcus aureus (n=118) clinical isolates from Maitama district hospital, Abuja, Nigeria. Out of the 118 clinical isolates of S. aureus employed for this study, only 56 isolates were biochemically confirmed as pathogenic S. aureus ; and these 56 isolates of S. aureus were tested for their antimicrobial susceptibility. Figure 1 shows the percentage distribution of the S. aureus isolates according to the specimens they were isolated from. Most of the isolated S. aureus came from abscess (29%), wound (11%), sputum (25%), urine (18%), swabs (5%), blood (5%), and semen (2%). The highest number of S. aureus isolates was from abscess samples (29%) while semen samples produced the lowest number of S. aureus isolates (2%). The antimicrobial susceptibility patterns of the isolated S. aureus are shown in Table 1.

medical-microbiology-diagnosis-Percentage-distribution-S.aureus

Figure 1: Percentage distribution of confirmed S. aureus isolates.

Most of the S. aureus isolates were susceptible to the tested antibiotics. The highest level of antibiotic susceptibility of the S. aureus isolates was observed against gentamicin (85.7%); and this was followed by vancomycin (80.4%), ciprofloxacin (62.5), linezolid (62.5) and erythromycin (53.6%). However, the S. aureus isolates still showed reduced susceptibility to some of the tested antibiotics – which are also vital for the treatment of infections caused by pathogenic S. aureus . The highest level of antibiotic resistance was observed against cefoxitin (82.1%), a cephamycin antibiotic with broad-spectrum of antimicrobial activity. Least susceptibility of the S. aureus isolates was also observed against tigecycline (71.4%), clindamycin (66.1%), amoxicillin-clavulanic acid (53.6%), sulphamethoxazole-trimethoprim (48.2%), chloramphenicol (48.2%) and erythromycin (46.4%) (Table 2). The result of the PCR amplification of Panton-valentine-leukocidin (PVL) genes in the isolated pathogenic S. aureus isolates is shown in Table 2. Figure 2 showed the amplicon of the PVL genes particularly LukS-PVL gene and LukF-PVL gene – which are responsible for PVL-mediated antimicrobial resistance and the virulence nature of pathogenic S. aureus isolates.

Antibiotics (µg)   Susceptible n (%) Resistant n (%)
Cefoxitin (30) 10 (17.9) 46 (82.1)
Gentamicin (10) 48 (85.7) 8 (14.3)
Linezolid (10) 35 (62.5) 21 (37.5)
Vancomycin (30) 45 (80.4) 11 (19.6)
Amoxicillin/clavulanic acid (20/10) 26 (46.4) 30 (53.6)
Tigecycline (15) 16 (28.6) 40 (71.4)
Chloramphenicol (30) 29 (51.8) 27 (48.2)
Ciprofloxacin (5) 35 (62.5) 21 (37.5)
Erythromycin (15) 30 (53.6) 26 (46.4)
Clindamycin (2) 19 (33.9) 37 (66.1)
Sulphamethoxazole-trimethoprim  (25) 29 (51.8) 27 (48.2)

Table 2: Antibiogram of S. aureus isolates (n=56).

medical-microbiology-diagnosis-Amplicons-LukF-PVL-gene-molecular

Figure 2: Amplicons of the LukF-PVL gene of S. aureus with a molecular size of 700 bp. Lane 1 is 100 bp molecular marker as a size marker, lane 2 is positive control, lanes 3-13 are different samples of the pathogenic S. aureus ; and lane 14 is negative control.

Out of the 56 isolates of pathogenic S. aureus used in this study, only 6 isolates of S. aureus (10.7%) were confirmed by PCR to harbour the PVL genes (Table 3). These 6 isolates of S. aureus tested positive for the presence of LukS-PVL gene (n=2) and LukF-PVL gene (n=4) as shown in Table 3. The LukF-PVL gene was more prevalent than the LukS-PVL gene is this study. A closer look at these 6 isolates of S. aureus that harboured the PVL genes in this study showed that 1 S. aureus was recovered from outpatients while the remaining 5 isolates of S. aureus was from inpatients. The PVL-positive S. aureus isolates were isolate from wound specimen (n=3), abscess (n=2) and from urine specimen (n=1).

Resistance marker   Number of positive isolates   Percent of positive isolates  
LukS-PVL 2 3.6
LukF-PVL 4 7.1
Total 6 10.7

Table 3: Prevalence of virulence-associated (PVL) genes amongst the S. aureus isolates (n=56).

Discussion

Pathogenic Staphylococcus aureus is responsible a plethora of nosocomial and community-acquired infections including wound burn infections, skin infections and urinary tract infections (UTIs); and this organism is a commonly isolated pathogen that may harbour some multidrug resistant genes that allow them to ward-off potent antimicrobial onslaught. This study determined the frequency of Panton-Valentine Leukocidin production (PVL) in clinical isolates of S. aureus clinical isolates from Maitama district hospital, Abuja, Nigeria. A total of 118 non-consecutive isolates of S. aureus was employed for this study, and only 56 isolates from wound infections, urine, abscesses, semen, blood, swabs and sputum specimens were biochemically confirmed to be pathogenic S. aureus isolates. All the S. aureus isolates were susceptible to a handful of the tested antibiotics. Overall, the S. aureus isolates were most susceptible to gentamicin (85.7%); and this was followed by vancomycin (80.4%), ciprofloxacin (62.5), linezolid (62.5) and erythromycin (53.6%). Vancomycin, erythromycin and linezolid are typical examples of antibiotics used for the treatment of infections caused by Gram positive bacteria, and the susceptibility of the S. aureus clinical isolates used in this study to these antimicrobial agents show that these antibiotics are still reliable for the treatment of infections caused by these pathogens. The susceptibility of the S. aureus isolates to these antibiotics is similar to the report of Terry et al. [12] and Shuaihua et al. [17] who reported similar susceptibility of S. aureus isolates to these antibiotics. Also in this study, the S. aureus isolates were also found to be highly resistant to the cephamycin, cefoxitin (82.1%). Reduced susceptibility was also recorded against tigecycline (71.4%), amoxycillin-clavulanic acid (53.6%), clindamycin (66.1%), sulphamethoxazole-trimethoprim (48.2%) and chloramphenicol (48.2%). The resistance of the S. aureus isolates to these antibiotics were however slightly different from the report of Suleiman et al. and Amini et al. [13]. Ghamba et al. [18] also reported lower resistance of S. aureus isolates to chloramphenicol, erythromycin, ciprofloxacin and gentamicin. The resistance of pathogenic S. aureus isolates to some readily available antibiotics is of immense clinical importance – owing to the fact that some of these organisms may be me multiply resistant, thus remaining undaunted even in the face of potent antimicrobial agents from different classes. The prevalence of PVL toxin genes in this study was 10.7%; and these S. aureus isolates that harboured the PVL toxin genes were from wound samples, abscess and urine samples. The prevalence of PVL toxin gene in this study is lower than the study of Shittu et al. [19] who reported that the prevalence of PVL toxin gene amongst Methicillin- Susceptible S. aureus (MSSA) was 40%. PVL-positive S. aureus isolates have been described from Germany, Ireland and from Australia as reported in this study [8-10,20,21]. This study conclusively reported a lower incidence of PVL-positive S. aureus of nosocomial origin in a local hospital in Nigeria; and it is thus critical to screen clinical isolates for the presence of these organisms in order to assuage any possible disease outbreak due to PVL-positive bacteria in this environment. The occurrence of PVL toxin gene in pathogenic S. aureus portends serious clinical implications – since most of these organisms are known to be multidrug resistant in nature. Thus, it is vital to lookout for PVLpositive S. aureus from clinical samples so that therapy can be properly guided.

Competing Interests

No competing interests exist.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 8379
  • [From(publication date):
    September-2016 - Oct 21, 2017]
  • Breakdown by view type
  • HTML page views : 8272
  • PDF downloads :107

Review summary

  1. jessical
    Posted on Nov 26 2016 at 6:51 pm
    ALL THANKS TO DR WILLIAMS. For 8 years my husband and i tried ceaselessly to conceive to no avail. The gynecologist told us that the Fibroid is causing difficulties and he recommended a surgery. I love my life so much and i did't want to undergo any surgery because i was told it's too painful and also there are 80% chances of it growing back. I was discussing this with a close colleague who told me how Dr williams helped her cousin cure fibroid. I contacted him and he was so amazing with encouragements and finally sent me a very effective medicine that changed my life for good. It has been four years now and i am still very fine and i have son i call my own naturally. You too can reach him too on [email protected] for his medicine
  2. drws
    Posted on Oct 17 2016 at 12:22 am
    Am Azeez, all thanks to Almighty Allah who used Dr Osaze to cure me of hepatitis B virus. I was deported from Dubai because of this sickness, I almost spent all I had, until I saw Dr Osaze recommendations and testimonies online, on how he has cured several people of chronic hepatitis B, and I decided to contact him, and he administered his herbal medication on me, and I became healed within a period of two months. In case you wants to contact him for a similar problem, or all other disease, you can reach him through +2349059942347 or email: [email protected]
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords