alexa Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New Species for Iranian Nematofauna and Some Other Known Nematodes from Iran Based on D2D3 Segments of 28 srRNA Gene | Open Access Journals
ISSN: 2157-7471
Journal of Plant Pathology & Microbiology
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New Species for Iranian Nematofauna and Some Other Known Nematodes from Iran Based on D2D3 Segments of 28 srRNA Gene

Somaye Alvani1, Esmat Mahdikhani Moghaddam1*, Hamid Rouhani1 and Abbas Mohammadi2

1Department of Plant Pathology, Ferdowsi University of Mashhad, Mashhad, Iran

2Department of Plant Pathology, University of Birjand, Birjand, Iran

*Corresponding Author:
Esmat Mahdikhani Moghaddam
Department of Plant Pathology
Ferdowsi University of Mashhad
Mashhad, Iran
Tel: +989155161529
Fax: +985138788875
E-mail: [email protected],
[email protected]

Received date: April 10, 2015 Accepted date: June 18, 2015 Published date: June 23, 2015

Citation:Alvani S, Moghaddam EM, Rouhani H, Mohammadi A (2015) Morphological, Molecular and Phylogenetic Study of Filenchus aquilonius as a New Species for Iranian Nematofauna and Some Other Known Nematodes from Iran Based on D2D3 Segments of 28 srRNA Gene. J Plant Pathol Microbiol S3: 001. doi:10.4172/2157-7471.S3-001

Copyright: ©2015 Alvani S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Plant Pathology & Microbiology

Abstract

Ziziphus zizyphus is very important crop in Iran. Because there isn’t any research of plant parasitic nematodes on Z. zizyphus, authors were encouraged to work on it. Nematodes isolated from the soil samples by whitehead method (1965) and permanent slides were prepared. Among the species Filenchus aquilonius is redescribed for the first time from Southern Khorasan province. F. aquilonius is characterized by lip region rounded, not offset, with fine annuls; four incisures in lateral line; Stylet moderately developed, 10-11.8 μm long with rounded knobs; Hemizonid immediately in front of excretory pore; Deirids at the level of excretory pore; Spermatheca an axial chamber and offset pouch; Tail about 120-157 μm, tapering gradually to a pointed terminus. For molecular identification the large subunit expansion segments of D2/D3 were performed for F. aquilonius to examine the phylogenetic relationships with other Tylenchids. DNA sequence data revealed that F. aquilonius had closet phylogenetic affinity with Irantylenchus vicinus as a sister group and with other Filenchus species for this region and placed them in one clade with 100% for bootstap value support. Phylogenetic position and additional information of other taxa in Tylenchidae from this region of Iran are included. . Evidence from the 28S gene strongly supports that Filenchus species are monophyletic. There is the first study of D2D3 segment of F. aquilonius and I. vicinus.

Keywords

Filenchus aquilonius; 28S rRNA; D2D3; Phylogeny; Nematodes; Southern Khorasan; Iran

Nematodes (Phylum Nematoda) are considered one of the most abundant and diverse animals on earth. They are found in terrestrial, freshwater, brackish, and marine environments [1] and play important ecological roles in soil ecosystems [2-4]. Application of integrative taxonomic approaches is useful for the identification of species based on both morphology and genome sequences [5]. This application has been useful for nematodes [6]. In the last two decades, molecular approaches have become more common to nematologists [7-9]. As a result, some new nematodes species descriptions are increasingly supported by molecular evidence [10,11]. The order Tylenchida includes the largest and economically most important group of plant parasitic nematodes so they have always Received ample taxonomic attention. Several attempts based of morphological and molecular characters for classification have been proposed for Tylenchids [12-29]. Maggenti et al. [30] proposed four suborders, The Tylenchina, Aphelenchina, Sphaerulariina and Hexatylina. Siddiqi [31,32] identified four suborders, Tylenchina, Hoplolaimina, Criconematina and Hexatylina and regarded the other suborder, Aphelenchina as a distinct order. The suborder Tylenchina sensu De Ley and Blaxter is represented by broad ecological diversity. Tylenchida infra orders Panagrolaimomorpha, Cephalobomorpha, and Tylenchomorpha. Plant parasites are found only in the infra orders Tylenchomorpha. Nematode taxonomy has been strongly based on morphological characters [33]. Nematode species are classically defined on the basis of these qualitative and quantitative characters. Although morphological information might help species diagnostics, these characters are homoplasious features in many cases, and do not adequately consider the possibility of convergent evolution. As a result, new species descriptions are increasingly supported by molecular evidence [34]. However, the study of morphology remains a critical necessity as morphology is the primary interface of an organism with its environment with key implications for development and ecology. Therefore, a more robust phylogeny based on a combination of morphological and molecular approaches is needed to clarify important relationships within Tylenchomorpha. There is general agreement that Tylenchida is monophyletic, whereas there is some disagreement regarding rank and discussion of polyphyly [35]. Typically Aphelenchida is regarded as a sister taxon to Tylenchida. Therefore, information and taxonomic resolution of the infra order Tylenchomorpha requires broader representation, including these little known groups [36].

The objectives of this study were: (1) Carry out a detailed morphological and morphometric characterization of Filenchus aquilonius Wu [37], Lownsbery and Lownsbery [38] as a new species for Iranian nematodes fauna; (2) Perform a molecular characterization of the new species and other known species of Tylenchidae from Iran for the first investigation of plant parasitic nematodes on three important crops Berberis vulgaris, Crocus sativus and Ziziphus zizyphus; (3) First register of D2D3 sequences of F. aquilonius, I. vicinus and Neopsilenchus magnidens in National Center for Biotechnology Information and (4) Found some information about phylogenetic relationship between Irantylenchus and Filenchus genus

Material and Methods

Soil samples

A total of 320 soil samples were collected in 2012- 2013 years from 20-50 cm depth of soil from South Khorasan province in Iran. In this study we obtained original sequences from five species of Tylenchids along with other sequences that were given from NCBI (Table 1). New sequences reported here have been deposited in GenBank under the accession number given in Table 1.

Species Host GeneBank accession
number
Boleodorusthylactus Ziziphuszizyphus KP313830
Filenchusaquilonius Ziziphuszizyphus KP313834
Irantylenchusvicinus Berberis vulgaris KP313833
Neopsilenchusmagnidens Berberis vulgaris KP313832
Psilenchushilarulus Crocus sativus KP313831

Table 1: Species were identified in this survey by host and GeneBank accession number of D2D3 segment of 28SrRNA.

Nematode extraction

The nematodes were extracted from soil samples using the tray method [39] and then handpicked under a Motic1000 dissecting microscope. The nematode specimens were heat killed by adding boiling 4% formalin solution then transferred to anhydrous glycerin according to De Grisse [40]. Measurements and drawings were performed using a drawing tube attached to an Olympus BH2 light microscope. Photographs were taken using an Olympus DP72 digital camera attached to an Olympus BX51 microscope. The ratios and the morphometric symbols used in morphometric tables of each specimen. Nematodes were identified based on morphological and morphometrical characters using identification keys.

DNA extraction

A single nematode specimen was selected, washed in a drop of clean water (a temporary slide was made for each individual) then transferred to a small drop of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0) on a sterilized slide and covered using a clean slide cover glass. The suspension (DNA sample) was recollected by adding 10 μl AE buffer and stored at -20°C as PCR templates.

PCR processing

Primers used for the amplification of D2-D3 domains were D2a (5’ACAAGTACCGTGAGGGAAAGT 3’) and D3b (5’TGCGAAGGAACCAGCTACTA3’) [41]. The 25 μl PCR mixture contained: 14 μl distilled water, 2.5 μl 10 × PCR buffer, 0.5 μl dNTP mixture, 1.5 μl 50 mM MgCl2, 1 μl of each primer (10 pmoles/μl), 0.5 μl of Taq DNA polymerase (CinaGen, Tehran, Iran, 5 u/μl), and 4 μl of DNA template. The thermal cycling program was as follows: an initial denaturation at 95ºC for 6 min, followed by 35 cycles of denaturation at 94ºC for 30 s, annealing at 47ºC for 30 s, and extension at 72ºC for 1 min. A final extension was performed at 72ºC for 10 min. PCR products were electrophoresed on 1% agarose gels and subsequently the gels were stained using Green viewer (SYBR).

Sequencing and phylogenetic analysis

The PCR products were sequenced after purification with PCR Pure Kit (Fermentase Company) in both directions using the same PCR primers using an ABI 3730XL sequencer (Bioneer Corporation, South Korea). The sequences chromatograms were checked using Bioedit software [42]. Forward and reverse sequences were assembled in DNA Baser. Sequences produced in the present study can be consulted on GenBank database. Fifty two sequences of the 28 srRNA region were retrieved from Genbank and aligned together with our sequences from this current study using Clustal X software (ver. 2) [43] with default parameters. The phylogenic trees were reconstructed using Bayesian inference (BI). Bayesian analysis was implemented on the data set with the GTR+I+G nucleotide substitution model, using MrBayes ver. 3.1.2 [44]. Analysis was for 2 millions generations. Reconstructed tree was observed with Fig. Tree ver. 1.3.1 software. The MEGA 5 program [45] and K2P model [46] was used to calculate nucleotides distance. For determination of identification percent the SDTv 1.0 software was used. In this survey, Rhabditis nidrosiensis (AM399067) was used as out group.

Results

We discuss only new species F. aquilonius (Figures 1 and 2). Photographs and measurements of other known species also provided (Figure 3, Tables 2 and 3).

Character Psilenchushilarulus Neopsilenchusmagnidens Boleodorusthylactus
  Female Female Female
n 6 9 8
L 1029 ± 143.3 (887.5-1224.5) 873.7 ± 40.7 (817.5-906) 483 ± 32.4 (437-526)
a 43.3 ± 0.9 (42.2-44.3) 34.1 ± 2.2 (31.2-36.2) 27 ± 2.2 (25-30.9)
b 7.1 ± 0.4 (6.4-7.5) 6.5 ± 0.8 (5.8-7.8) 4.8 ± 0.2 (4.4-5.2)
c 7.7 ± 1.3 (6.7-9.7) 6.2 ± 0.8 (5.4-7.3) 7.8 ± 0.9 (6.8-9.1)
c’ 8.7 ± 1.7 (6.2-10.0) 9.8 ± 2.0 (7.8-12.2) 5.9 ± 0.5 (5.1-6.8)
V 49.8 ± 2.6 (47.8-53.5) 66.5 ± 3.1 (62.9-70.1) 65.6 ± 1.2 (63.8-67.4)
V’ 57.3 ± 2.2 (55.1-59.6) 79.4 ± 2.1 (76.3-81.1) 75.4 ± 1.1 (73.2-76.5)
Stylet 13 ± 0.7 (12.5-14) 12.6 ± 0.9 (12-14) 10.0 ± 1.6 (8.5-12)
Pharynx length 144.5 ± 19.8 (128.5-173.5) 144.5 ± 7.4 (138-155) 100.1 ± 5.1 (94-107)
MB 55.7 ± 2.5 (53.6-59.1) 44.1 ± 2.6 (40.5-47) 51.2 ± 4.7 (46.7-61)
S-E pore 117.3 ± 21.3 (100.5-148.5) 108.8 ± 5.6 (104.5-117) 82.3 ± 3.4 (79-87)
Head-Vulva 515.2 ± 95.9 (445.5-656) 581.6 ± 34.5 (555.5-632.5) 317.6 ± 24.6 (283-355)
Vulva-Anus 381 ± 54.5 (311-443.5) 150.3 ± 18.1 (135-176.5) 103.3 ± 9.9 (91.5-119)
Maximum body width 23.7 ± 3.3 (20-28) 25.7 ± 2.7 (23-29) 17.9 ± 1.2 (16-19)
PVS - 11.5 ± 2.6 (9-15) 5.4 ± 1.3 (3-7)
Tail length 132.7 ± 10.4 (125-148) 141.7 ± 20.0 (122-159) 62.4 ± 5.8 (51.5-70)
Width in vulva 23.6 ± 2.8 (20-27) 25.3 ± 2.2 (23-27.5) 15.6 ± 1.7 (13-18)
Width in anus 15.6 ± 3.0 (13-20) 14.5 ± 1.0 (13-15.5) 10.5 ± 0.9 (9-12)
T/VA 0.3 ± 0.0 (0.2-0.4) 0.9 ± 0.1 (0.8-1.1) 0.6 ± 0.0 (0.4-0.6)
G1 24.3 ± 3.0 (21.6-27.3) - -
G2 25.6 ± 0.6 (24.9-26.3) - -

Table 2: Morphometric characters of Psilenchus hilarulus, Neopsilenchus magnidens and Boleodorus thylactus collected from Iran. All measurements are in μm and in the form: mean ± s.d. (range).

Origin characters Filenchusaquilonius Irantylenchusvicinis
  Female Male Female Male
n 13 3 7 2
L 835.3 ±38.7 (771.5-910.5) 823 ±99.0 (747-935) 803.1 ±111.2 (645-906) 822 ±16.9 (810-834)
a 33.2 ±2.8 (29.9-37.7) 36.2 ±3.2 (33.4-39.7) 34.7 ±3.7 (31.7-40.2) 43.8 ±0.0 (43.7-43.8)
b 5.9 ±0.3
(5.3-6.6)
6.0 ±0.6 (5.5-6.8) 5.6 ±0.6 (4.7-6) 5.9 ±0.0 (5.9-6)
c 5.8 ±0.3 (5.2-6.4) 4.8 ±0.4 (4.4-5.1) 5.2 ±0.2 (4.8-5.4) 4.9 ±0.1 (4.8-5.0)
c’ 9.7 ±0.9 (8.1-11.1) 9.9 ±0.6 (9.1-10.3) 11.8 ±2.4 (10.2-15.4) 10.9 ±0.2 (10.7-11.1)
V 63.3 ±3.4
(60.3-72.3)
- 63.2 ±1.4 (62.4-65.5) -
V’ 75.1 ±1.0 (73.6-76.5) - 77.1 ±1.0 (76.2-78.6) -
Stylet 10.6 ±0.5
(10-11.8)
11 ±0.5 (10.5-11.5) 11.6 ±0.2 (11.5-12) 11.2 ±0.3 (11-11.5)
Pharynx length 140.5 ±3.8 (136-146.5) 136.3 ±2.5 (133.5-138.5) 140.7 ±7.0 (135-151) 109 ±1.4 (108-110)
MB 43.9 ±1.1
(42.4-45.4)
44.2 ±1.4 (42.5-45.3) 45.1 ±1.9 (43.1-47.4) 41.7 ±1.0 (41-42.4)
S-E pore 110.7 ±4.4
(105.5-121.5)
105.3 ±7.5 (98.5-113.5) 105.2 ±9.5
(91.5-113.5)
109 ±1.4 (108-110)
Head-vulva 528.9 ±30.6
(490.5-587)
- 501.2 ±69.5
(403-566.5)
-
Vulva-anus 174.4 ±9.2
(159.5-193.5)
- 148 ±18.8
(120-160)
-
Maximum body width 25.2 ±2.0 (21.5-28) 22.6 ±1.4 (21-23.5) 23.1 ±2.8 (19.5-26) 18.7 ±0.3 (18.5-19)
PVS 11.0 ±1.6 (9-14) - 15.6 ±2.0 (13-17.5) -
Tail length 141.9 ±10.1 (120-157) 169.3 ±17.7 (151.5-187) 153.8 ±25.9 (122-185.5) 167.2 ±8.1 (161.5-173)
Width in vulva 23.9 ±1.5 (21.5-25.5) - 22.3 ±2.3 (19-24.5) -
Width in anus 14.6 ±1.2 (13-17) 17 ±0.8 (16.5-18) 13.1 ±1.9 (11-15) 15.2 ±0.3 (15-15.5)
T/VA - - 1.0 ±1.2 (0.9-1.2) -
Spicule - 18.5 ±1 (17.5-19.5)   21.5 ±0.7 (21-22)
Gubernaculum - 6.4 ±0.1 (6.3-6.5)   4.4 ±0.1 (4.3-4.5)

Table. 3: Morphometric characters of Filenchus aquilonius and Irantylenchus vicinis collected from Iran. All measurements are in μm and in the form: mean ±s.d. (range).

plant-pathology-microbiology-Filenchus-aquilonius

Figure 1: Filenchus aquilonius. Anterior end with oesophageus (A), Excretory pore (B), Vulva and Ovary with special spermetheca (C), Lateral lines in vulva region (D), Tail in female genus (E), Lateral lines in middle of the body (F), Spicules in male genus (G) and bursa (H).

plant-pathology-microbiology-Ovary-with-spermetheca

Figure 2: Filenchus aquilonius. Anterior end of female (A) and male (B), Stylet (C), Body in female (D) and male (E), Deirid (F), Ovary with spermetheca (G), Tail in female (H) and male (I), Lateral lines (J).

plant-pathology-microbiology-Neopsilenchus-magnidens

Figure 3: Anterior end of Psilenchus hilarulus (A), Neopsilenchus magnidens (B), Irantylenchus vicinus (C) and Boleodorus thylactus (D).

Material examined

13 females and 3 males from one location, in good state of preservation.

Measurements

Measurements are given in Table 3.

Female: Body tapering gradually from the vulva to a narrowly pointed posterior end, slightly curved ventrally at vulval region Cuticular annulation rounded with ca 1.56±0.14 (1.5-1.9 μm) width. Lateral field with four lines, ca 5.11±0.45 (4.5-6 μm) width, inner two very faint, outer pair distinct, crenate. Cephalic region continuous with body contour, not separated, rounded, not striated ca 7.1±0.21 (7-7.5 μm) width and 3.46±0.17 (3-3.8 μm) height. Amphids not seen. Stylet moderately developed, basal knobs rounded. Median bulb, ca 8.5±0.71 (7.5-10 μm) width and ca 13.07±0.83 (11.5-14 μm) height. Isthmus thin, slender, encircled by nerve ring. Terminal bulb pyriform, abutting intestine, ca 11.62±1.26 (10-14.5 μm) width and ca 25.11±1.97 (21-28 μm) height. Excretory port ca 110.7±4.48 from anterior end. Hemizonid immediately anterior of the excretory pore. Oesophagointestinal valve conoid. Vulva a simple transverse slit, flush with body contour. Vagina perpendicular to body axis. Reproductive system monodelphic, prodelphic. Ovary outstretched, oocytes in single row. Spermatheca oval shaped, an axial chamber and offset pouch separated by narrowing. Post vulval sac ca 11.05±1.6 (9-14μm) length. Tail elongate-conoid, narrowing perceptibly to a finely-pointed (needlelike) tip ca 141.95±10.12 (120-157) in length.

Male: General morphology similar to that of female but slightly slender. Testis single, anteriorly outstretched. Spicules sickle shaped ca 18.5±1 (17.5-19.5μm) in length, gubernaculum distinct, rod shaped with slightly curved top and measuring about 6.43±0.11 (6.3-6.5 μm). Bursa adanal, with crenate margin, extending approximately at the same distance anteriorly and posteriorly from cloaca.

Discussion

Morphometrical and Molecular characterization and phylogenetic relationships of F. aquilonius

The Iranian population of F. aquilonius did not differ with the main description of F. aquilonius. F. aquilonius show similarity to F. orbus. It can be easily distinguished from F. orbus in having a weaker spear and much finer annulation on lip region. An, obvious difference is the position of the excretory pore (anterior the nerve ring in F. orbus vs behind the nerve ring in F. aquilonius). The median esophageal bulb more ovate and body annulation coarser.

In this survey, this is a first report of this new species of Ziziphus zizyphus from the southern Khorasan province, Iran.

The partial sequencing of the 28S rRNA D2-D3 segment for F. aquilonius yielded 720 bp nucleotides. A phylogenetic tree was inferred from Bayesian analysis and showed F. aquilonius is a close sister group with other Filenchus species.

NBLAST analysis based on 28S gene for Iranian population of F. aquilonius (KP313834) attributed 96% similarities with Filenchus sp. (JQ005015) and F. annulatus (JQ005017).

The phylogenetic trees reconstructed based on partial sequences of D2-D3 segment of 28S sequence, using the Bayesian analysis, showed F. aquilonius (KP313834) to be form a monophyletic group with other Filenchus species (Figure 4) and placed them in one clade with 100% bootstrap value support. Athighi et al. [47] also showed that Filenchus species are monophyletic based on 28SrRNA.

plant-pathology-microbiology-newly-sequenced-taxa

Figure 4: Bayesian 50% majority rule consensus tree inferred from 57 sequences of the D2-D3 domains of the 28S rRNA under the GTR+I+G model. The newly sequenced taxa/isolates are bold.

In the phylogenetic tree F. aquilonius (KP313834) was also placed in the one clade with I. vicinus by 100% bootstrap value support (Figure 4). Results of SDTv 1.0 software also showed 97.7% similarity between F. aquilonius and I. vicinus (Figure 5). Irantylenchus has a very similar morphology to the species of the genus Filenchus, except for three differences in the head region: (1) the amphidial aperture is a straight longitudinal (2) the stylet knobs are dorsally amalgamated and clavate (or the ventral knob are not developed) resulting in a ventrally situated opening of the pharyngeal lumen (3) the dorsal gland opening is found one half to one stylet length posterior to the knobs (Figure 3). Other characters are similar to the Filenchus genus: Cephalic framework delicate, stylet with conus about one-third of total stylet length, deirids near excretory pore, cuticle finely annulated, median bulb muscular, posterior bulb offset, cardia distinct, female genital tract prodelphic, vulva a transverse slit without flaps, spermatheca an offset pouch, post vulval uterine sac short, ad-vulval papillae present, Tail elongated conoid, male with paired hypoptygmata on anterior cloacal lip, arcuate spicules and symmetrical ad-cloacal bursa. There are some hypotheses regarding the genus Irantylenchus. This genus was proposed as a subgenus of Tylenchus while describing Tylenchus (Irantylenchus) clavidorus. This new species was at the same time compared with the very similar Tylenchus vicinus and both species are mentioned to belong to the same new subgenus, but without transferring this species to the new subgenus. Kheiri [48] didn’t designate his new species as type species, but being the sole representative of the new (sub) genus Tylenchus. Andrássy [49] raised the subgenus to genus rank. The combination Irantylenchus vicinus is used for the first time in Brzeski and Sauer [50] but also without mentioning its transfer. Both species are now considered to be synonyms [51]. In this survey F. aquilonius placed by with I. vicinus in one clade with high bootstrap value support (100%), So Irantylenchus will be a very close genus to Filenchus based on 28SrRNA. Further investigation is needed for this genus. Based on Ashrafi et al. [52] these two genera also are very close phylogenetic relationship based on SSU of rRNA and they also placed in one clade.

plant-pathology-microbiology-Pairwise-identity

Figure 5: Pairwise identity between species based on SDTv 1.0 software. Brown and red color show higher percentage of identity between species.

In this survey Psilenchus hilarulus is grouped with high bootstrap value support (100%) as basal taxa of some Belonolaimidae representatives sensu De Ley and Blaxter [53]. Siddiqi [54] distinguished four families within the superfamily Dolichodoroidea, namely Psilenchidae, Telotylenchidae, Dolichodoridae and Belonolaimidae Genus Psilenchus, was grouped with strong support with genera of the subfamily Merlininae . The present study also indicated a close relationship between Psilenchidae and Merlinidae. Surprisingly, this clade includes only stunt nematode genera that bear deirids (except Scutylenchus which lacks deirids) and phasmids. These are sense organs laterally located at the anterior (level of basal bulb) and posterior (tail) region of the body, respectively. Such morphological features are also found in Psilenchus and therefore it was suggested by Ryss [55] as a synapormophy (“lateral complex”) to group these genera. In fact, Siddiqi recognized Psilenchus and Atetylenchus in a separate family (Psilenchidae) and did not consider them to be closely related to other Tylenchidae genera (i.e. Aglenchus, Coslenchus), but instead placed them within the superfamily Dolichodoroidea which includes all the stunt nematodes (e.g. Nagelus, Merlinius, etc).

Based on the D2D segment of 28S rRNA, Subbotin et al. [56] further explored the relationships within Tylenchomorpha and added some controversy on the position of some Tylenchidae and Belonolaimidae genera. In particular, the Tylenchidae genera (i.e. Aglenchus, Coslenchus and Boleodorus) were grouped together but not at the most basal position of the tree as in Bert et al. [57] and Holterman et al. [58,59]. In this survey also these species placed in one clade with each other. All other species also placed near same species in the tree (Figure 5). Within Tylenchidae, the genera Aglenchus, Coslenchus, and Filenchus are recovered as monophyletic with high branch support (100%). Moreover, the genera Boleodorus and Neopsilenchus are also strongly supported as monophyletic with high branch support (100%). Siddiqi classified the former three genera under the subfamily Tylenchinae and the later under Boleodorinae, both as Tylenchidae.

It seems that most molecular phylogenies show economically important plant parasite nematodes to be nested within clades of fungal-feeding Tylenchomorpha. These phylogenies have been based on a single gene approach, either SSU or LSU gene. Therefore, some relationships within Tylenchomorpha are still unresolved, especially at the lower taxonomic levels (i.e. family and genus). In order to rigorously test these hypotheses, a more comprehensive phylogeny is required, especially including under represented taxa (i.e. Tylenchidae and Belonolaimidae) as well as DNA sequences from multiple genes.

Acknowledgements

The authors appreciate the kind help of Dr. M. Pedram to take pictures of samples in Tarbiat Moddares University and Tiago José Pereira (Ph. D. student, Department of Nematology, University of California, Riverside) for helping. The authors thank of Ferdowsi University of Mashhad for providing equipment and support in this research.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 11657
  • [From(publication date):
    specialissue-2015 - Oct 18, 2017]
  • Breakdown by view type
  • HTML page views : 7877
  • PDF downloads :3780
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords