alexa Multiplex PCR-based detection of Salmonella typhimurium and Salmonella enteritidis in Specific Pathogen Free (SPF) and Commercial Eggs | OMICS International
ISSN: 2327-5073
Clinical Microbiology: Open Access
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Multiplex PCR-based detection of Salmonella typhimurium and Salmonella enteritidis in Specific Pathogen Free (SPF) and Commercial Eggs

Jakeen El Jakee1, Diaa El Din Gad Khelfa2, Monier Mohammed El-Safty3, Ahmed Adel Seida1*, Sherif Marouf1, Jens Hahne4, Zafar Mahmood5 and Sarah Sobhy Nagy3

1Department of Microbiology and Immunology, Faculty of Veterinary Medicine, Cairo University, Egypt

2Department of Poultry and Rabbit Diseases, Faculty of Veterinary Medicine, Cairo University, Egypt

3Quality Control of SPF Eggs Department in Central Laboratory for Evaluation of Veterinary Biologics (CLEVB) Abassia, Cairo, Egypt

4Institute of Cancer Research, London, England

5Graduate School of Life Sciences, University of Würzburg, Würzburg, Germany

*Corresponding Author:
Ahmed Adel Seida
Microbiology and Immunology Department, Faculty of Veterinary Medicine
Cairo University, Giza, P.O. 12211, Egypt
Tel: 0020237175004
E-mail: [email protected]

Received date: February 23, 2016; Accepted date: March 28, 2016; Published date: April 04, 2016

Citation: El Jakee J, Khelfa DEDG, El-Safty MM, Seida AA, Marouf S, et al. (2016) Multiplex PCR-based detection of Salmonella typhimurium and Salmonella enteritidis in Specific Pathogen Free (SPF) and Commercial Eggs. Clin Microbiol 5:241. doi:10.4172/2327-5073.1000241

Copyright: © 2016 El Jakee J, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Clinical Microbiology: Open Access

Abstract

Salmonella serovars are one of the major bacterial causes of food borne diseases. Eggs are commonly identified as food sources responsible for salmonellosis outbreaks. This study aimed to isolate Salmonella typhimurium and Salmonella enteritidis from 1750 hens’ eggs, and use of multiplex polymerase chain reaction (Multiplex PCR) in the identification of different Salmonella serovars from eggs. The incidence of salmonellae among the Balady eggs yolk was 1.3%, while the incidence was 1.2% among white and brown eggs samples (each). S. typhimurium and S. enteritidis were identified (0.6 and 0.5% respectively). The isolates were confirmed using fliC, sefA genes and gene specific for genus Salmonella. All albumen samples negative for isolation of isolation of salmonellae by culture method were retested by PCR.

From the retested albumen samples 3%, 8.4% and 6% collected from balady, white and brown eggs respectively were positive for Salmonella serovars using Multiplex PCR. No salmonellae could be detected from specific pathogen free (SPF) eggs using both PCR and conventional methods.

Keywords

Eggs; SPF; Multiplex PCR; S. typhimurium ; S. enteritidis

Introduction

Contamination of eggs has been identified as one of the major causes of food borne Salmonella [1]. In the United States all cases of Salmonella contamination of eggs were reported to the Centre for Disease Control and Prevention [2]. There are two pathways for eggs to become internally contaminated with Salmonella , direct contamination occurs during the formation of an egg in the ovary and oviduct of hens; whereas, indirect contamination occurs after penetration of salmonella e the egg shell membrane [3].

Salmonella pullorum or Salmonella gallinarum in the ovules before ovulation likely and probably constitutes the chief mode of vertical transmission [4]. The majority of human illnesses caused by Salmonella enteritidis are attributed to the consumption of contaminated eggs [5].

The aim of this study was to determine S. typhimurium and S. enteritidis in eggs of balady, white, brown and SPF layer breed collected from different governorates using conventional microbiology detection compared to that detected using Multiplex-PCR technique.

Materials and Methods

Samples

Total 1750 eggs were collected from balady (n=1000), brown (n=250), white (n=250) and SPF (n=250) eggs from Kafr El sheikh, Elqalubia, El Monofia, Al Fayoum, EL Menia farms and from the SPF egg producing project (Koom Ousheem-Al Fayoum), Egypt. Egg yolk and egg albumins were collected from each egg and these samples were cultured within 24 hrs from collection.

Identification of Salmonellae

Under complete sterile condition each egg was cleaned by cotton swab soaked in alcohol. The egg was broken in a Petri dish plate then egg yolk and egg albumin were collected by two separate syringes. Detection of Salmonella was carried out according to ISO 6579: (2002) [6]. The samples were cultured on xylose lysine deoxycholate (XLD) and brilliant green agar (BGA) plates. The suspected colonies on XYD and BGA plates were picked up for microscopically examination by Gram's stain before being transferred into semisolid and slope agar for preservation and further identification. Salmonella isolates were identified biochemically and serologically as reported in previous literatures [7,8].

Detection of the genus Salmonella using the multiplex PCRbased assay

DNA was extracted from the examined samples using QIAamp® DNA Mini kit (catalog no. 51304, QIAGEN GmbH, Germany) according to manufactures recommendations. The PCR was conducted according to modified Oliveira protocol using specific primers as shown in table 1 [9]. The primers were prepared by Sigma Company in Germany according to Soumet et al., [10] and amplified PCR products were analyzed gel electrophoresis in 1% agarose gel.

Target sequence Primer sets Primer sequence 5'→3' Amplification region (bp)
Random sequence ST11 GCCAACCATTGCTAAATTGGCGCA 429
ST15 GGTAGAAATTCCCAGCGGGTACTGG
fliC gene Fli15 CGGTGTTGCCCAGGTTGGTAAT 559
Tym ACTCTTGCTGGCGGTGCGACTT
sefA gene Sef167 AGGTTCAGGCAGCGGTTACT 312
Sef478 GGGACATTTAGCGTTTCTTG

Table 1: Primers used for the detection of Salmonella species [10].

Results

Detection of the Salmonella serovars among the examined eggs

The highest number of isolates was recovered from the balady eggs collected from Kafr El sheik (2.7%) and EL Monofia (3%). The incidence was 1.2% from both the white and brown eggs as shown in table 2. All isolates of salmonella e were recovered from yolk samples only. The results revealed that 13 serovars (1.3%) were isolated from the yolk samples of balady eggs and serotyped as 7 S. typhimurium and 6 S. enteritidis . Three serovars (1.2%) were isolated from the yolk of white eggs and serotyped as 2 S. typhimurium and one S. enteritidis . Also 3 serovars (1.2%) were isolated from the yolk of brown eggs and serotyped as 2 S. enteritidis and one S. typhimurium as shown in table 3. It is also clear that all SPF eggs were free from salmonella e infections.

Type of eggs Number of the examined eggs Number of Salmonella isolates Percentage (%) Governorates
White 250 3 1.20%  
150 2 1.30% Kafr El sheik
100 1 1% Elqalubia
Brown 250 3 1.20%  
100 1 1% Elqalubia
150 2 1.30% El Monofia
Balady 1000 13 1.30%  
250 2 0.80% EL Sharkia
250 2 0.80% Al Fayoum
250 2 0.80% EL Menia
150 4 2.70% Kafr EL Sheik
100 3 3% EL Monofia
SPF 250 - 0% Al Fayoum
Total 1750 19 1.09%  

Table 2: Prevalence of Salmonella serovars recovered from the examined eggs.

Type of eggs Salmonella serovars Total
S. enteritidis S. typhimurium    
No. % No. % No. %
Balady eggs(1000) 6 0.6 7 0.7 13 1.3
White eggs(250) 1 0.4 2 0.8 3 1.2
Brown eggs (250) 2 0.8 1 0.4 3 1.2
SPF eggs (250) - 0 - 0 - 0
Total 1750 9 0.5 10 0.6 19 1.3

Table 3: Salmonella serovars isolated from the egg yolk of the balady, brown and white eggs.

Confirmation of the isolates using multiplex PCR

Using primers specific for Genus Salmonella , for S. enteritidis (sefA gene) and S. typhimurium (filC gene) serovars, Multiplex PCR was used to identify the specific isolates. All isolates were positive for amplification of 429 bp specific for Genus Salmonella . Furthermore, S. enteritidis and S. typhimurium isolates were positive for amplification of 312 bp and 559 bp respectively (Figure 1).

clinical-microbiology-Agarose-gel-electrophoreses

Figure 1: Agarose gel electrophoreses showing amplification of 429, 559 and 312 bp fragments from the extracted DNA of Salmonella isolates. Lane 1: 100 bp DNA marker (GibcoBRL), Lanes 2, 4, 9 and 12: positive amplification of 559 bp fragment of S. typhimurium isolates, Lanes 3, 5, 8 and 11: positive amplification of 312 bp fragments of S. Enteritidis isolates, Lane 12: positive control (S. Typhimurium ATCC 13076), Lanes 6 and 7 negative control (S. aureus ATCC 29737) and Lane10: negative control (distilled water).

Direct detection of the Salmonella from egg albumin using the multiplex PCR

All albumen samples collected from the examined eggs were retested by m PCR for detection of S. enteritidis and S. typhimurium . It is clear that 66 (4.4%) out of 1500 albumin samples were positive for salmonella e, 48 (3.2%) and 18 (1.2%) samples were positive for S. enteritidis and S. typhimurium respectively. Among the balady eggs, 21 (2.1%) and 9 (0.9%) samples were positive for S. enteritidis and S. typhimurium respectively. From the white egg albumin samples, 17 (6.8%) and 4 (1.6%) samples were S. enteritidis and S. typhimurium respectively. The albumin samples of the brown eggs recorded 10 (4%) and 5 (2%) positive samples for S. enteritidis and S. typhimurium respectively as shown in table 4 and figure 2.

Types of egg Number of examined albumin samples Amplified PCR product
429 bp (Genus Salmonella) n (%) 312 bp (S. Enteritidis) n (%) 559 bp (S. Typhimurium) n (%)
Balady 1000 30 (3%) 21 (2.1%) 9 (0.9%)
White 250 21 (8.4%) 17 (6.8%) 4 (1.6%)
Brown 250 15 (6%) 10 (4%) 5 (2%)
Total 1500 66 (4.4%) 48 (3.2%) 18 (1.2%)

Table 4: Direct detection of the Salmonella from egg albumin samples using the multiplex PCR.

clinical-microbiology-egg-albumen

Figure 2: Agarose gel electrophoreses showing amplification of 429 bp, 559 bp and 312 bp fragments from the egg albumen samples. Lane 1: 100bp DNA marker (GibcoBRL), Lanes 2, 4, 5, 6, 8, 9,11 and 12: positive amplification of 429 bp fragment of Salmonella species, Lanes 2, 4, 6, 9 and 12: positive amplification of 559 bp fragment of S. typhimurium , Lanes 5, 8 and 11: positive amplification of 312 bp fragment of S. enteritidis , Lane 12: positive control S. typhimurium (ATCC 13076), Lane 10: negative control S. aureus (ATCC 29737), Lanes 3 and 7: negative control distilled water.

Discussion

Salmonella contamination of eggs has been identified as a public health concern worldwide. Globally, Salmonella is one of the most prevalent causes of food borne illness [3].

The present data revealed that 19 Salmonella isolates were isolated from 1500 examined balady, white and brown eggs (1.3%). Earlier Salmonella was isolated by Jones et al., [11] from 72.0% of all samples collected from the laying house environment (flush water, ventilation fan, egg belt, and egg collector samples).

It is clear that 10 S. typhimurium and 9 S. enteritidis were identified serologically with incidence of 0.6 and 0.5% respectively. Salmonella enteritidis and S. typhimurium as well as other serotypes have been isolated from egg shells and egg content [12].

The two most commonly identified causative agents of food borne salmonellosis are Salmonella enterica serotypes typhimurium and enteritidis [13]. Both serotypes have the ability to colonize the reproductive organs of hens and are major causes of food borne illness [3].

S. enteritidis is more commonly linked to contaminated eggs, except in Australia, where the majority of egg-related food borne salmonellosis is caused by S. typhimurium [14-16]. It has been concluded that S. enteritidis could penetrate the egg shell easier than other serotypes so they supposed that horizontal transmission of Salmonella in eggs is of less importance than the vertical transmission [17]. Hen's eggs are the most important vehicle of the S. enteritidis infection in humans [18].

The most commonly used technique for Salmonella detection is the conventional culture technique. The polymerase chain reaction (PCR) method required only 2 days, compared to the 5 days required by conventional selective enrichment and serological tests for Salmonella serovars the culture method and the sensitivity of this assay was approximately less than 1 CFU/600 g of egg pool [19].

A polymerase chain reaction for the specific detection of the gene sequence, sefA , encoded by all isolates of Salmonella enteritidis, was developed previously by Woodward and Kirwan [20].

The PCR assay proved by Seo et al., [20] to be a rapid and highly sensitive test for detection of low concentrations of Salmonella in egg samples. PCR represents a rapid procedure to detect Salmonella in a food sampled. In this study, sefA and filC genes were amplified to confirm the isolates as well as to detected S. enteritidis and S. typhimurium directly from egg albumen samples. While no albumen sample was detected by the microbiological method, 21 (2.1%) and 9 (0.9%) samples from Balady eggs, 17 (6.8%) and 4 (1.6%) samples from white egg albumin samples and 10 (4%) and 5 (2%) from brown eggs were positive for S. enteritidis and S. typhimurium respectively. PCR is a sensitive method with a superior ability to detect Salmonella spp. in the presence of other competing bacteria [21,22].

All examined albumen samples were negative for isolation of salmonella e by culture method. Egg white proteins, such as lysozyme and ovotransferrin, are well known to play important roles in defense against bacterial invader Baron et al. [23]. Using PCR, 3%, 8.4% and 6% albumen samples collected from balady, white and brown eggs respectively were positive for Salmonella serovars . Salmonella DNA could be detected from infertile eggs which incidence was higher than that by bacteria isolation [24]. Salmonella strains grow better in fresh egg white than in egg white of 2 or 3 weeks old [17]. In fresh eggs, only few salmonella s are present and as albumen is an iron-restricted environment, growth will only occurs once storage-related changes to vitelline membrane permeability, which allows salmonella e to invade yolk contents, have taken place, when this happens high populations are achieved in both yolk contents and albumen [25]. In the present study 48 and 18 cases were positive to S. enteritidis and S. typhimurium respectively using m PCR. Baron et al., [23] reviewed critically assesses the available evidence on the antimicrobial components of egg white. In addition, mechanisms employed by S. enteritidis to resist egg white exposure are also considered along with various genetic studies that have shed light upon egg white resistance systems. The egg-contamination capacity of S. enteritidis includes its exceptional survival capability within the harsh conditions provided by egg white [23].

Multiplex PCR is a sensitive method with a superior ability to detect Salmonella spp. in the presence of other competing bacteria. Although Salmonella contamination of eggs is a complex issue that is influenced by many variables, making it difficult to implement appropriate management strategies. Further research is required to explore different protocols to ensure control of Salmonella through temperature and pH of food products. There is also a need to reeducate food handlers and consumers of the risk from raw eggs and cross contamination of food products and reduce the public health risk.

Conflict of Interest

The authors declare that there is no conflict of interests.

Acknowledgements

The authors gratefully acknowledge Dr. Zafar Mahmood from Germany and Dr. Jens Hahne from England for their scientific input, experimental planning and revising the manuscript critically for important intellectual content.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 8886
  • [From(publication date):
    April-2016 - Apr 27, 2018]
  • Breakdown by view type
  • HTML page views : 8752
  • PDF downloads : 134

Review summary

  1. Jones FT
    Posted on Jul 13 2016 at 7:48 pm
    The manuscript by Jakee and co-workers investigates the presence of Salmonella sp. in eggs using multiplex PCR-based assay for fliC, sefA genes specific for Salmonella sp. The authors detected Salmonella typhimurium and Salmonella enteritidis in hen egg samples. The findings of this manuscript addresses the concerns related to the risk of Salmonella infection associated with the consumption of eggs. The experimental approach is appropriated and the manuscript well written.
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version