alexa Nanosized TiO2 Exposure Resulted in Neurotoxicity via Impairing NMDA Receptor-mediated Postsynaptic Signaling Cascade in Mice | Open Access Journals
ISSN: 2157-7439
Journal of Nanomedicine & Nanotechnology
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Nanosized TiO2 Exposure Resulted in Neurotoxicity via Impairing NMDA Receptor-mediated Postsynaptic Signaling Cascade in Mice

Lei Sheng1#, Ling Wang2#, Yuguan Ze1#, Xiaoyang Zhao1#, Xiaohong Yu1, Jie Hong1, Dong Liu1, Bingqing Xu1, Xiaoyu Pan1, Anan Lin1, Yue Zhao1, Chi Zhang1, Yunting Zhu1, Yi Long1 and Fashui Hong1*

1Medical College of Soochow University, Suzhou 215123, China

2Library of Soochow University, Suzhou 215021, China

#equally to this work

*Corresponding Author:
Fashui Hong
Medical College of Soochow University
Suzhou 215123, China
Tel: +86-0512-61117563
Fax: +86-0512- 65880103
E-mail: [email protected]

Received Date: May 12, 2014; Accepted Date: June 02, 2014; Published Date: June 07, 2014

Citation: Sheng L, Wang L, Ze Y, Zhao X, Yu X, et al. (2014) Nanosized TiO2 Exposure Resulted in Neurotoxicity via Impairing NMDA Receptor-mediated Postsynaptic Signaling Cascade in Mice. J Nanomed Nanotechnol 5:203. doi:10.4172/2157-7439.1000203

Copyright: © 2014 Sheng L, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Nanomedicine & Nanotechnology

Abstract

The central nervous system (CNS) toxicity induced by exposure to nano-sized particles is of great concern, but the mechanism of how this toxicity may be incurred has yet to be elucidated. Here, we examined how N-methyl-D-aspartate (NMDA) receptor-mediated postsynaptic signalling cascade may be affected by titanium dioxide particles (TiO2 NPs) exposure for six consecutive months to contribute to the observed neurotoxicity. The results suggest that long-term exposure to TiO2 NPs led to titanium accumulation and iron reduction in the blood and hippocampus tissues, and significant hippocampal injury as well as reduction of learning and memory in mice. The CNS injuries following longterm TiO2 NP exposure were closely associated with significant reductions in NR1, NR2A, NR2B, calcium/calmodulindependent protein kinase II, postsynaptic density protein 95, nuclear activated extracellular-signal regulated kinase (ERK1/2), Dexras1, CAPON, peripheral benzodiazepine receptor-associated protein, and divalent metal transporter as well as elevation of synaptic Ras GTPase- activating protein and neural nitric oxide synthase in the hippocampus. It implies that long-term exposure to TiO2 NPs may induce neurotoxic effects via impairing NMDA receptor-mediated postsynaptic signalling cascade in animals.

Keywords

Titanium dioxide nanoparticles; Hippocampus; N-methyl-D-aspartate receptors; Postsynaptic signalling proteins; Neurotoxicity

Introduction

Titanium dioxide nanoparticles (TiO2 NPs) have been used in various areas, including pigment [1], paints [2], medicine [3], sunscreens [4], cosmetics [5], food additives and food packaging [6,7], and in environmental decontamination systems [8,9]. However, numerous studies demonstrated that TiO2 NP exposure can conduct the damages of central nervous system (CNS) [10-17]. For instance, Wang et al. [12] indicated that TiO2 NPs damaged CA1 region of the hippocampus and caused high inflammatory responses by elevating TNF-α and IL-1β levels, oxidative stress in the exposed mice [13]. Shin et al. [18] demonstrated that TiO2 NPs induced TNF-α and IL- 1β expression and enhanced nuclear factor-κB (NF-κB) binding activity by increasing microglial activation in the pre-inflamed brain of mice, and led to an exaggerated neuroinflammatory response. Our numerous studies suggested that exposure to TiO2 NPs resulted in excessive species reactive oxygen (ROS) production and decreased antioxidant capacity [15], calcium overload, proliferation of glial cells, and altered contents trace elements neurotransmitters [19], led to hippocampal apoptosis via mitochondrial or the intrinsic pathway [16] and a reduction in spatial recognition memory in mice [16,19]. Furthermore, TiO2 NP-induced oxidative damage in the mouse brain was demonstrated to be via the p38-Nrf-2 signaling pathway [20], and TiO2 NP-induced neuroinflammation was associated with activation of the TLRs/TNF-α/NF-κB pathway [21]. However, the mechanisms of how this neurotoxicity are not understood.

N-methyl-D-aspartate receptors (NMDARs), which are glutamategated ion channel receptors, are widely expressed in the CNS and play pivotal roles in excitatory synaptic transmission, synaptic plasticity, learning and memory of mammalian brain [22]. NMDARs include different subunits within a repertoire of three subtypes: NR1, NR2 (NR2A-D) and NR3 (NR3A and NR3B) [23]; and NR1 and either NR2B or NR2A are most widely expressed [22]. Exposure to TiO2 NPs was demonstrated to increase glutamate release [19], and to inhibit NR2A and NR2B expression as well as to impair long-term potentiation (LTP) in rat or mouse hippocampus [24,25]. Therefore, we hypothesize that these changes mentioned above may further lead to the impairment of postsynaptic signalling cascade in the brain.

In excitatory synapses of the brain, specific receptors in the postsynaptic membrane can rapidly respond to the release of glutamate from the presynaptic terminal. Upon stimulation, these glutamate receptors activate postsynaptic signaling pathways that transduce signals into the postsynaptic neuron [26]. NMDAR activation can result in either LTP or long-term depression (LTD) of synaptic strength. NMDARs are embedded in the postsynaptic density (PSD), which involved in the postsynaptic membrane that contains a variety of scaffolding and signaling proteins. Many of the prominent proteins in the PSD fraction bind directly or indirectly to the NMDA receptor. Thus, the PSD fraction contains a core NMDA receptor-signaling complex, and serves as the signaling scaffold to bridge NMDARs to the intracellular signaling complexes [27-29] and is required to sustain the molecular organization of the postsynaptic density [30]. PSD- 95 can also interact with a host of cytoplasmic signaling molecules, such as neuronal nitric oxide synthase (nNOS) and SynGAP, thereby connecting NMDARs to divergent signal transduction pathways [26]. Its overexpression can inhibit LTP and decrease LTD induction [28,31,32]. Synaptic GTPase-activating protein (SynGAP) is a synaptic Ras GTPase-activating protein (RasGAP) that interacts with PSD-95 in vitro and in vivo. It stimulates GTPase activity of Ras, which shows that it negatively regulates Ras activity at excitatory synapses [33]. SynGAP was demonstrated to play a critical role in the regulation of neuronal mitogen-activated protein kinase (MAPK) signaling, α-amino- 3-hydroxyl-5-methyl-4-isoxazole-proprionte glutamate receptor (AMPAR) membrane trafficking and excitatory synaptic transmission, and its overexpression led to a marked decrease of extracellular signalregulated kinase (ERK) 1/2 activation [34]. While MAPK/ERK pathway plays a pivotal role in learning and memory [28,35,36]. In addition, NMDA receptor stimulation of nNOS activates Dexras1. Glutamate via NMDA receptors triggers cellular Ca2+ entry with calcium-calmodulin activating nNOS [37], whose binding to CAPON provides a mechanism for nitric oxide (NO) delivery to Dexras1, leading to S-nitrosylation of Dexras1 on cysteine-11 [38,39]. Therefore, the NMDA-NO-Dexras1- peripheral benzodiazepine receptor-associated protein (PAP7)- divalent metal transporter (DMT1)-iron uptake signaling cascade was suggested to mediate NMDA neurotoxicity [40]. Our previous study showed that TiO2 NPs not only decreased expression of NR2A, NR2B, calcium/calmodulin-dependent protein kinase IV (CaMKIV), cyclic-AMP responsive element binding protein (CREB)-1, and CREB- 2, and inhibited LTP [25], but also activated NOS and increased NO overproduction [15,19], and reduced iron content in mouse brain [19], these may interfere with the expression of NMDA receptor and postsynaptic signaling proteins mentioned above. However, the NMDA receptor-mediated postsynaptic signaling cascade caused by TiO2 NPs in the hippocampus remains unclear.

In view of the above, the aim of the present study was to evaluate brain injury, and alterations in the expression of NR2A, NR2B, PSD-95, ERK1/2, SynGAP, Dexras1, CAPON, PAP7, nNOS, and DMT1 in mouse hippocampus, and to determine whether TiO2 NP-induced neurotoxic effects via impairing NMDA receptor-mediated postsynaptic signaling cascade in the hippocampus caused by TiO2 NP exposure.

Materials and Methods

Chemicals

Hydroxypropyl methylcellulose (HPMC) K4M was purchased from Sigma-Aldrich Company. Cell Lysis Kits were purchased from GENMED SCIENTIFICS INC (USA). Enzyme linked immunosorbent assay (ELISA) commercial kits were purchased from R&D Systems (USA). Other chemicals were purchased from Shanghai Chemical Co. (China).

The preparation, characteristics of TiO2 NPs including the anatase structure, size, surface area, mean hydrodynamic diameter and ζ potential, have been described in our previous work [16,41]. X-raydiffraction (XRD) were used to detect the anatase structure and size with a charge-coupled device (CCD) diffractometer (Mercury 3 Versatile CCD Detector; Rigaku Corporation, Tokyo, Japan) using Ni-filtered Cu Kα radiation. The NP size was determined using a TecnaiG220 transmission electron microscope (TEM) (FEI Co., USA). The surface area of NPs was determined by Brunauer–Emmett–Teller (BET) adsorption measurements on a Micromeritics ASCORBIC ACIDP 2020M+C instrument (Micromeritics Co., USA). The average aggregate or agglomerate size and ζ potential of NPs was measured by dynamic light scattering (DLS) using a Zeta PALS+BI-90 Plus (Brookhaven Instruments Corp., USA). XRD measurements suggested that TiO2 NPs showed the anatase structure. The average particle size of powdered TiO2 NPs suspended in 0.5% w/v HPMC solvent after 24 h (5 mg/mL) incubation ranged from 5 to 6 nm, and the surface area was 174.8 m2/g. The mean hydrodynamic diameter of TiO2 NPs in HPMC solvent (5 mg/mL) ranged from 208 to 330 nm (mainly 294 nm), and the ζ potential after 24 h incubation was 9.28 mV [16].

Animals and treatment

One hundred and sixty CD-1 (ICR) female mice (24 ± 2 g) were purchased from the Animal Center of Soochow University (China). The mice were housed in stainless steel cages in a ventilated animal room. The room temperature in the housing facility was maintained at 24 ± 2°C, with a relative humidity of 60 ± 10% and a 12 h light/ dark cycle. Distilled water and sterilized food were available ad libitum. Before treatment, the mice were acclimated to this environment for five days. All the animals were handled in accordance with the guidelines and protocols approved by the Care and Use of Animals Committee of Soochow University (China).

For the experiment, the mice were randomly divided into four groups (N=40 in each group), including a control group (treated with 0.5% w/v HPMC) and three experimental groups (1.25, 2.5, or 5 mg/kg BW TiO2 NPs). The mice were weighed, volume of TiO2 NP suspensions was calculated for each mouse, and the fresh TiO2 NP suspensions were administered to the mice by nasal administration every day for 6 months. Any symptom or mortality was observed and recorded carefully everyday during the 6 months. In addition, the mice were regularly handled and weighed before the behavioral experiments.

Behavioral experiment

Following the 6 months of TiO2 NP administration, the acquisition of spatial recognition memory was determined using the Y-maze in mice (N=10 in each group). In order to avoid any stress-related interference with the learning procedure, mice were not handled by the experimenter but were allowed to voluntarily enter the maze. To assess spatial recognition memory, the Y-maze test consisted of two trials separated by an intertrial interval (ITI). The Y-maze was consisted of three arms and was randomly designated: Start arm, in which the mouse started to explore (always open), Novel arm, which was blocked during the 1st trial, but open during the 2nd trial, and other arm (always open). The maze was placed in a sound attenuated room with dim illumination. The floor of the maze was covered with sawdust, which was mixed after each individual trial in order to eliminate olfactory stimuli. Visual cues were placed on the walls of the maze, and the observer was always in the same position at least 3 m from the maze. Assay of acquisition of spatial recognition memory in mice was described in previous reports [42,43].

To measure spatial recognition memory, the number of entries and time spent in each arm of the maze by each mouse was recorded and novelty versus familiarity was analyzed by comparing behavior in all three arms. The number of arms visited was taken as an indicator of locomotor and exploratory activity.

Preparation of hippocampus

After behavioral detection, mice were weighed. Blood samples were collected from the eye vein by rapidly removing the eyeball. The hippocampi from all animals were quickly dissected from brains and placed in ice-cold dish.

Analysis of titanium and iron content

The hippocampi were thawed and approximately 0.1 g samples were weighed, then these tissues and 5 ml blood were digested, and analyzed for titanium, and iron content (N=5 in each group). Briefly, prior to elemental analysis, the blood and hippocampal tissues were digested overnight with nitric acid (ultrapure grade). After adding 0.5 mL of H2O2, the mixed solutions were incubated at 160°C in high pressure reaction containers in an oven until the samples were completely digested. Then, the solutions were incubated at 120°C to remove any remaining nitric acid until the solutions were colorless and clear. Finally, the remaining solutions were diluted to 3 mL with 2% nitric acid. Inductively coupled plasma-mass spectrometry (Thermo Elemental X7; Thermo Electron Co., Waltham, MA, USA) was used to determine the titanium, and iron concentration in the samples. Indium of 20 ng/mL was chosen as an internal standard element. The detection limit of titanium, and iron was 0.089 ng/mL, and 0.062 ng/ mL, respectively.

Histopathological examination

For pathologic studies, all histopathologic examinations were performed using standard laboratory procedures. Briefly, hippocampi (N=5 in each group) were embedded in paraffin blocks, then sliced (5 μm thickness) and placed onto glass slides. After hematoxylin–eosin staining, the stained sections were evaluated by a histopathologist unaware of the treatments, using an optical microscope (Nikon U-III Multi-point Sensor System, Japan).

Assay of gene and protein expression

The levels of mRNA expression of NR1, NR2A, NR2B, CaMKII, PSD-95, SynGAP, ERK1/2, Dexras1, CAPON, PAP7, DMT1, and nNOS in the hippocampi were determined using real-time quantitative RT polymerase chain reaction (RT-PCR) (N=5 in each group) [44-46]. Synthesized cDNA was used for the real-time PCR. Primers were designed using Primer Express Software according to the software guidelines (Table 1). Total RNA was extracted from individual hippocampi using from the homogenates was isolated using Tripure Isolation Reagent (Roche, USA) according to the manufacturer’s instructions. The RT reagent (Shinegene Co., China) of 30 μl was prepared by mixing 15 μl of 2×RT buffer, 1 l random primer in a concentration of 100 pmol.μl-1, 1μl of RTase, 5 μl RNA, and 8 μl DEPC water together. The reaction condition was 25°C for 10 min, 40°C for 60 min, and 70°C for 10 min. The internal reference gene was actin3. qRT-PCR was performed using the 7500 Real-time PCR System (ABI) with SYBR Premix Ex Taq™ (Takara) according to the manufacturer’s instructions. The RT-qPCR data were processed with the sequence detection software version 1.3.1 following the method of Schefe et al. [47], analyzed based on the standard curve using the threshold cycle (Ct) model for relative quantification [45] and the expression levels of mRNA of all genes were normalized by the contents of actins mRNAs.

Gene name Description Primer sequence Primer size (bp)
Refer-actin mactin-F 5'-GAGACCTTCAACACCCCAGC-3'  
mactin-R 5'-ATGTCACGCACGATTTCCC-3' 263
NR1 mNR1-F 5'-CAGTGCCCCAGTGCTGTTAT-3'  
mNR1- R 5'-CTCTCCCATCATTCCGTTCC-3' 164
NR2A mNR2A F ATGAACCGCACTGACCCTAAG  
mNR2A R GGCTTGCTGCTGGATGGA 246
NR2B mNR2B F AATGTGGATTGGGAGGATAGG  
mNR2B R ATTAGTCGGGCTTTGAGGATACT 255
CaMKII mCaMKII -F 5'- AGTCCAGTTCCAGCGTTCAGT -3'  
mCaMKII -R 5'- GGGTCGCACATCTTCGTGTA -3' 166
PSD-95 mPSD-95-F 5'-GTTCCCCGACAAGTTTGGAT-3'  
mPSD-95-R 5'-CTCGCACAGACTGGACGCT-3' 191
SynGAP mSynGAP-F 5'-ATCCACGCTTAACCCCACA-3'  
mSynGAP-R 5'-CTCATACTCCTTCACCCTGTCC-3' 175
ERK1/2
(Mapk1)
mERK1/2-F 5'-GCACCGTGACCTCAAGCC-3'  
mERK1/2-R 5'-TGCAGCCCACAGACCAAA-3' 212
Dexras1 mDexras1-F 5'-CCATCGAGGACTTCCACCG-3'  
mDexras1-R 5'-GCTGAACACCAGAATGAAAACG-3' 146
CAPON mCAPON-F 5'-ACAGACATTGACGCCGTGG-3'  
mCAPON-R 5'-TCCTGAGGGTGGGGTGAGA-3' 137
PAP7 mPAP7-F 5'-GAGAAGTCGTCACCGTCCG-3'  
mPAP7-R 5'-AAATAAACCCCAAACCCAATG-3' 100
nNOS mnNOS-F 5'-CGCTGCTACAACCTCGCTAC-3'  
mnNOS-R 5'-TGAGCCAGGAGGAGCACAC-3' 144
DMT1 mDMT1-F 5'-TCACCATCGCAGACACTTTTG-3'  
mDMT1-R 5'-GACAGGACGGCACGAACAT-3' 174

Table 1: Real time PCR primer pairs. PCR primers used in the gene expression analysis.

To determine protein levels of NR1, NR2A, NR2B, CaMKII, PSD-95, SynGAP, ERK1/2, Dexras1, CAPON, PAP7, DMT1, and nNOS in the hippocampi, total protein from the frozen hippocampal tissues (N=5 in each group) from experimental and control mice was extracted using Cell Lysis Kits (GENMED SCIENTIFICS INC.USA) and quantified using BCA protein assay kits (GENMED SCIENTIFICS INC.USA). ELISA was performed using commercial kits that were selective for each respective protein (R&D Systems, USA), following the manufacturer’s instructions. The absorbance was measured on a microplate reader at 450 nm (Varioskan Flash, Thermo Electron, Finland), and the concentrations of NR1, NR2A, NR2B, CaMKII, PSD- 95, SynGAP, ERK1/2, Dexras1, CAPON, PAP7, DMT1, and nNOS were calculated from a standard curve for each sample.

Statistical analysis

All results are expressed as means ± SD. The Kolmogorov-Smirnov test with Dunn’s post test was used to compare control and treated groups using SPSS 19 software (SPSS, Inc., Chicago, IL, USA). A P-value<0.05 was considered statistically significant.

Results

Spatial recognition memory and locomotor activity

Table 2 exhibits effects of TiO2 NPs on the spatial recognition memory of mice. It can be observed that the percentage duration in the novel arm in control mice was significantly higher than that in the start and other arms, whereas the percentage duration in the novel arm in 1.25, 2.5, or 5 mg/kg BW TiO2 NP-exposed mice was significantly decreased as compared to the control mice throughout the experiment (P<0.05), respectively, suggesting that long-term exposure to TiO2 NPs reduced leaning and memory of mice. To confirm effects of TiO2 NPs on locomotor activity of mice, number of arm visits was also examined and are presented in Figure 1. With increased TiO2 NP dose, the number of arm entries markedly decreased (P<0.05).

Percentage of duration of visits (%) Control 1.25 mg/kg 2.5 mg/kg 5 mg/kg
Novel arm 44 ± 5.5 30 ± 4.2* 16 ± 2.8** 6 ± 1.7***
Start arm 26.5 ± 2.9 32 ± 4.1* 38 ± 5.7* 42 ± 5.9**
Other arm 29.5 ± 3.3 38 ± 5.1* 46 ± 6.6** 52 ± 7.8**

Table 2: Effect of TiO2 NPs on the spatial recognition memory of mice in Y-maze after nasal administration of TiO2 NPs for six consecutive months.

nanomedicine-nanotechnology-locomotor-mice-maze

Figure 1: Effects of TiO2 NPs on locomotor activity of mice in Y-maze after nasal administration of TiO2 NPs for six consecutive months. **p<0.01, and ***p<0.01. Values represent means ± D (N=10).

Titanium and iron contents

Figure 2 presents titanium and iron contents in the blood and hipocampus caused by TiO2 NP exposure. With increased TiO2 NP dose, there were significant increases of titanium levels, whereas iron levels were markedly reduced in the blood and hipocampus (Figure 2, P<0.01). Titanium content in the control mice was negligent (Figure 2). The increased titanium and decreased iron may lead to hippocampal injury and impairment of hippocampal function, which were confirmed by the assays of NMDA receptor and postsynaptic signalling factors as well as histopathological observations of mouse hippocampus.

nanomedicine-nanotechnology-titanium-blood-hippocampus

Figure 2: Titanium and iron contents in the blood and hippocampus of mice after nasal administration of TiO2 NPs for six consecutive months. *p<0.05, **p<0.01, and ***p<0.01. Values represent means ± SD (N=5).

Hippocampal histopathological observations

Following long-term exposure to 1.25, 2.5, or 5 mg/kg BW TiO2 NPs, histopathological changes from hippocampal CA region were observed (Figure 3B-3D), which suggested significant edema of glial cells, disperative replication of neuron cells, decreased size of cell volume, nuclear irregularity, and necrosis or abscission of neuron cells.

nanomedicine-nanotechnology-histopathology-hippocampus-nasal

Figure 3: Histopathology of CA region of hippocampus in mice after nasal administration of TiO2 NPs for six consecutive months. (a) Control group indicates great nucleus and limpid nucleolus of glial cells and pyramidal cells; (b) 1.25 mg/kg BW TiO2 NP group indicates disperative replication of pyramidal cells, edema of glial cells; (c) 2.5 mg/kg BW TiO2 NP group indicates disperative replication of pyramidal cells, decreased size of cell volume, nuclear irregularity; (d) 5 mg/kg BW TiO2 NP group indicates degeneration, necrosis or abscission of neuron cells.

Expression of NMDA receptor subunit and postsynaptic signaling factor

In the present study, actin3 was chosen as the endogenous control gene. The expression level of the actin3 gene was constant, with an expression ratio of almost one in all the samples (data not listed). Therefore, using this gene as a reference, changes in the expression levels of the 12 NMDA receptor subunit and/or postsynaptic signaling factor genes were evaluated and compared following exposure to TiO2 NPs for six consecutive months (Table 3).

Ratio of gene/actin (Fold) Control 1.25mg/kg 2.5mg/kg 5mg/kg
NR1 1.02 ± 0.15 0.85 ± 0.11 0.36 ± 0.06** 0.25 ± 0.04**
NR2A 0.84 ± 0.09 0.55 ± 0.06* 0.27 ± 0.03** 0.21 ± 0.02**
NR2B 0.68 ± 0.07 0.45 ± 0.04* 0.29 ± 0.04** 0.18 ± 0.02***
CaMKII 1.13 ± 0.15 0.88 ± 0.12 0.49 ± 0.05** 0.31 ± 0.03***
PSD-95 0.72 ± 0.08 0.47 ± 0.05* 0.32 ± 0.03** 0.21 ± 0.01***
SynGAP 0.37 ± 0.02 0.62 ± 0.04* 0.81 ± 0.06* 0.98 ± 0.09**
ERK1/2(Mapk1) 4.57 ± 0.35 2.96 ± 0.24* 2.44 ± 0.22* 1.84 ± 0.19**
Dexras1 3.94 ± 0.29 2.46 ± 0.21* 1.56 ± 0.18** 1.01 ± 0.12***
CAPON 0.67 ± 0.08 0.42 ± 0.05* 0.34 ± 0.03** 0.25 ± 0.02**
PAP7 1.27 ± 0.13 0.75 ± 0.08* 0.42 ± 0.04** 0.21 ± 0.02***
nNOS 3.72 ± 0.31 5.05 ± 0.46* 6.39 ± 0.57* 10.56 ± 1.08***
DMT1 0.85 ± 0.07 0.54 ± 0.05* 0.36 ± 0.04** 0.22 ± 0.02***

Table 3: Effect of TiO2 NPs on mRNA expression of gene in mouse hippocampus after nasal administration of TiO2 NPs for six consecutive months.

Long-term exposure to TiO2 NPs resulted in a dose-dependent marked decrease in the mRNA and protein expression of NMDA receptor subunits, including NR1, NR2A and NR2B in the hippocampus (Tables 3 and 4), suggesting reductions of 16.67%, 64.71% and 75.49%; 15.63%, 67.8% and 78.07% for NR1; reductions of 34.52%, 67.85% and 75%; 41.18%, 71.67% and 78.39% for NR2A, reductions of 33.82%, 57.35% and 73.53%; 15.63%, 62.41% and 77.11% for NR2B, respectively.

Protein expression (ng/g tissue) Control 1.25 mg/kg 2.5 mg/kg 5 mg/kg
NR1 58.14 ± 3.91 49.05 ± 3.55 18.72 ± 1.93** 12.75 ± 1.52***
NR2A 49.56 ± 3.55 29.15 ± 2.46* 14.04 ± 1.52** 10.71 ± 1.25***
NR2B 40.12 ± 3.62 33.85 ± 2. 5 15.08 ± 1.85** 9.18 ± 1.21***
CaMKII 67.88 ± 5.12 56.64 ± 5.05 25.48 ± 2.27** 15.81 ± 1.32***
PSD-95 43.25 ± 3.61 24.91 ± 2.26* 16.64 ± 1.42** 10.71 ± 1.05***
SynGAP 18.53 ± 1.62 32.24 ± 2.83* 43.74 ± 3.58* 54.88 ± 4.89***
ERK1/2 182.86 ± 12.31 115.44 ± 8.51* 92.72 ± 6.36* 64.69 ± 5.33**
Dexras1 236.48 ± 16.58 159.96 ± 11.26* 96.72 ± 8.85** 58.58 ± 6.39***
CAPON 40.22 ± 3.21 27.31 ± 2.36* 21.08 ± 2.23* 14.56 ± 1.38**
PAP7 76.28 ± 5.85 48.75 ± 3.27* 26.04 ± 2.31** 12.18 ± 1.18***
nNOS 212.04 ± 13.62 257.95 ± 15.89 389.79 ± 25.68** 654.72 ± 45.71***
DMT1 51.55 ± 4.71 43.78 ± 3.59 19.88 ± 2.09** 12.98 ± 1.04***

Table 4: Effect of TiO2 NPs on levels of protein expression of gene in mouse hippocampus after nasal administration of TiO2 NPs for six consecutive months.

To confirm NMDA receptor-mediated postsynaptic signaling cascade, the levels of several postsynaptic signaling factors, including CaMKII, PSD-95, SynGAP, ERK1/2, Dexras1, CAPON, PAP7, DMT1, and nNOS in mouse hippocampus, were analyzed by RT-PCR and ELISA. As the dose of TiO2 NPs increased, there were significant reductions in CaMKII, PSD-95, ERK1/2, Dexras1, CAPON, PAP7, and DMT1 expression; whereas there were marked increases of SynGAP and nNOS expression in the hippocampi (Tables 3 and 4, P<0.05).

Discussion

In the current study, the effects of long-term exposure to TiO2 NPs on the expression of NMDA receptor and postsynaptic signalling factors in mouse hippocampus were evaluated. The TiO2 NP accumulation was confirmed by the markedly increased titanium levels in the blood and hippocampus (Figure 2), suggesting that TiO2 NPs can easily cross blood-brain barrier into the hippocampus, depositing TiO2 NPs in the hippocampus (Figure 2) and damaging hippocampus (Figure 3). In addition, TiO2 NP exposure resulted in reductions of iron contents in the blood and hippocampus (Figure 2). Our previous study has been demonstrated that exposed mice to TiO2 NPs presented low iron content [20]. Numerous studies demonstrated that TiO2 NP accumulation and iron deficiency in mouse brain resulted in excessive production of species reactive oxygen (ROS), and increased peroxidation levels [15-17,19,48-50], which may damage hippocampus. The Y maze is regarded as one of common behavioral tasks to evaluate cognitive abilities of rodents. Hippocampus-dependent spatial learning and memory are frequently investigated by observing the behavioral performance of animals in the Y maze. The results of this study indicated that longterm exposure to TiO2 NPs resulted in decreases in spatial recognition memory (Table 2), for example, the time spent in the unfamiliar novel arm in the TiO2 NP-exposed mice was lower than unexposed mice (Table 2). Locomotor activity acts as a function of the excitability level of the CNS [51]. The present study shows that TiO2 NP exposure for six consecutive months decreased locomotor activity in mice (Figure 1), which is consistent with our previous reports [15-17,19-21,25]. Decreased spatial cognition of mice caused by TiO2 NP exposure may be closely associated with the accumulation of TiO2 NPs, reduction of iron uptake and the damaged hippocampus. Furthermore, decreased spatial cognition of mice may be triggered through NMDA receptormediated postsynaptic signaling cascade in the hippocampus.

The present study shows that long-term exposure to TiO2 NPs significantly decreased NR1, NR2A and NR2B in the hippocampus (Tables 3 and 4), which is consistent with our previously reported results [25]. This finding supports our assumed alteration of NMDA receptor in the TiO2 NP-exposed mice. Numerous important NMDA receptor properties are influenced by the subunits composing the receptor assembly [52]. It was reported that LTP in the hippocampus is specifically related to NR2A-containing NMDARs [53]. TiO2 NP exposure was suggested to markedly inhibit the induction and establishment of LTP in rats and mice [24,25]. Alteration of NMDA receptor expression may affect expression of postsynaptic signaling factors. Upon NMDA receptor stimulation, CaMKII is endlessly induced and is essential for NMDAR-dependent LTP [54]. CaMKII expression has been demonstrated to play an important role in learning, memory, and synaptic plasticity [55]. Toscano et al. [56] demonstrated that Pb2+ exposure could decrease CaMKII activity and expression in rats. In current study, reduced NR1, NR2A and NR2B and CaMKII expression were found in the TiO2 NP-exposed mice, suggesting that TiO2 NPs may disrupt the normal NMDA receptor assembly and the function of CaMKII. Our previous finding also indicated that TiO2 NP exposure led to reductions of CaMKIV activity and expression, spatial cognition, and synaptic plasticity in mice [25]. As a signaling scaffold, PSD-95 brings intracellular signaling complexes close to NMDAR channels. PSD-95 bridges the Ca2+ influx to the specific downstream signaling events [29]. Our data suggest that with increased TiO2 NP dose, decreased PSD-95 expression in the hippocampus was significantly observed (Tables 3 and 4), which would impair the molecular organization of the postsynaptic density, synaptic strength and plasticity [30]. SynGAP had been demonstrated to be a negative regulator of Ras at excitatory synapses [33], and to be inhibited by CaMKII phosphorylation [57]. Furthermore, ERK activation had been suggested to play an important role in the consolidation and reconsolidation of recognition memory [58]. In the present study, our data show that TiO2 NP exposure significantly reduced CaMKII expression and increased SynGAP expression, leading the inhibition of ERK1/2 expression in mouse hippocampus (Tables 3 and 4).

Nitric oxide (NO) may not freely diffuse to reach its physiological targets but may be conveyed to these sites by interactions of NOS with other proteins [40]. As shown by reports, nNOS can bind to the PSD- 95/93, which in turn binds to NMDA receptors [59,60]. This ternary complex enables NO to S-nitrosylate NMDA receptors and alters their signaling [61]. Therefore, we presume that increased nNOS expression and decreased PSD-95 expression caused by TiO2 NPs may influence NO to S-nitrosylate NMDA receptors and interfere their signaling in the hippocampus.

CAPON was identified to be a 55 kDa protein that contains a C-terminal domain that binds to the PDZ domain of nNOS and an N-terminal phosphotyrosine binding (PTB) domain [38], and interacts with Dexras1 [40,62,63]. While Dexras1 shares about 35% homology with the Ras subfamily of proteins and contains all of the conserved domains of typical GTPases, and has also been designated activator of G protein signaling 1 (AGS1) or RASD1 [40,64], activating extracellular signal-regulated kinases 1, 2 (ERK1, 2) [65-67]. PAP7 is proved to bind to DMT1, the only known physiological import channel for iron, activation of NMDA receptor stimulates nNOS, resulting in S-nitrosylation and activation of Dexras1, which induces iron uptake via interactions with PAP7 and DMT1. Glutamate, acting via NMDA receptors, activates nNOS to form NO [37], which leads to protein S-nitrosylation [68]. This modification activates Dexras1, which, by its link to PAP7, augments both Tf-mediated and NTBI uptake. From Figure 3, we observed a marked reduction of the Fe content in the TiO2 NP-exposed hippocampus. The roles of intraneuronal iron are involved in synthesis, packaging of neurotransmitters, uptake as well as degradation of the neurotransmitters into other iron-containing proteins that may directly or indirectly alter brain function through peroxide reduction, amino acid metabolism and fat desaturation, thus changing postsynaptic membrane functioning [69]. In the present study, long-term exposure to TiO2 NPs significantly decreased levels of ERK1/2, Dexras1, CAPON, PAP7, and DMT1 expressions and elevated nNOS level (Tables 3 and 4), which may be associated with reduction of iron uptake (Figure 2), thus impairing NMDA-NO-Dexras1-PAP7- DMT1-iron uptake postsynaptic signaling cascade in the hippocampus [70].

Conclusion

Mice were exposed to TiO2 NPs for six consecutive months, titanium accumulation and iron reduction in the blood and hippocampus tissues were observed, which in turn resulted in significant hippocampal injury and reduction of spatial cognition in mice. The CNS injuries following long-term TiO2 NP exposure may be closely associated with NMDA receptor-mediated postsynaptic signaling cascade, marked by significant reductions in NR1, NR2A, NR2B, CaMKII, PSD-95, ERK1/2, Dexras1, CAPON, PAP7, and DMT1 expressions as well as elevations of SynGAP and nNOS expressions in the hippocampus. Therefore, the application of TiO2 NPs should be carried out cautiously, especially in humans.

Acknowledgement

This work was supported by National Natural Science Foundation of China (grant No. 81273036, 30901218), A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions, and the National Bringing New Ideas Foundation of Student of Soochow University (grant No. 201310285040Z).

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Recommended Conferences

  • Nano Congress for Next Generation
    August 31-September 01, 2017 Brussels,Belgium
  • Graphene & 2D Materials
    September 14-15, 2017 Edinburgh, Scotland

Article Usage

  • Total views: 11555
  • [From(publication date):
    June-2014 - Jul 23, 2017]
  • Breakdown by view type
  • HTML page views : 7785
  • PDF downloads :3770
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords