alexa Overexpression of Porcine Kit Gene in Transgenic Mice Does not Affect Melanogenesis

ISSN: 2168-9849

Cloning & Transgenesis

  • Research Article   
  • Clon Transgen 2017, Vol 6(2): 159
  • DOI: 10.4172/2168-9849.1000159

Overexpression of Porcine Kit Gene in Transgenic Mice Does not Affect Melanogenesis

Jin Seop Ahn1, Ga Ram Kim1,2, Seong Hong Jang1, Dong-Hwan Kim1,3, Seongsoo Hwang4, Incheol Cho5 and Jeong-Woong Lee1,3*
1Biotherapeutics Translational Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon, 34141, Republic of Korea
2Division of Animal and Dairy Science, College of Agriculture and Life Science, Chungnam National University, Daejeon, 34134, Republic of Korea
3Department of Functional Genomics, University of Science and Technology, Daejeon, 34113, Republic of Korea
4Animal Biotechnology Division, National Institute of Animal Science, Wanju 55365, Republic of Korea
5Animal Genetics and Bioinformatics Division, National Institute of Animal Science, Wanju 55365, Republic of Korea
*Corresponding Author: Jeong-Woong Lee, Biotherapeutics Translational Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon, 34141, Republic of Korea, Tel: +82-42-860-4428, Fax: +82-42-860-4608, Email: [email protected]

Received Date: Sep 28, 2017 / Accepted Date: Oct 26, 2017 / Published Date: Oct 31, 2017

Abstract

The Kit gene is proto-oncogene, encoded stem cell factor and involved in melanocyte development. Also, Kit is expressed in epidermis and proliferation of melanoblasts which occur to pigmentation in skin, eyes and other tissues. Here we established porcine Kit genes overexpressed transgenic mice. The role of Kit gene was regulation in melanogensis remains unclear in porcine. Therefore, present study aims to ectopic expression porcine Kit gene in pigmentation of skin tissues. Our results showed that no effect on melanogenesis in ectopic Kit gene overexpressed transgenic mice. Further studies on Kit gene will provide insight into other specific roles in porcine and mice species.

Keywords: Kit gene; Transgenic mice; Skin; Melanogenesis

Introduction

The proto-oncogene Kit is a tyrosine kinase receptor (as known as c-Kit and CD117), which codes for encoding stem cell factor (SCF), involved in differentiation, proliferation, chemotaxis, and apoptosis through Kit receptor activated by its ligand [1]. Also Kit gene has been reported in hematopoietic progenitor/stem cells, tissue mast cells, germ cells, interstitial cells of Cajal and melanocyte [2]. SCF is specific ligand of Kit; it is activated by Kit ligand and plays a key role in haematopoiesis, melanogenesis and spermatogenesis [3]. Kit has been observed in malignant tumors and melanoma [4,5]. SCF/Kit signaling is required for migration and survival of pigment precursors [6]. It is important for the migration, proliferation, and differentiation of melanoblasts [7]. Melanotic disorders are into hypermelatotic and hypomelanocytic, which are because of absence of melanocyte number or melanin deficiency and reduction. Initially melanogenesis is occur to melanoblast migration from the neural crest by myoblast development pathway key regulated genes such as paried-box 3 (PAX3), sex-determining region Y-box (SOX10), microphthalmia transcription factor (MITF), endothelin 3 (EDN3), endothelin receptor B (EDNRB) and Kit [8]. In mammals, melanin is synthesized through catalyzed by specific enzyme complexes such as phenylalanine (PAH), tyrosinase-related protein 1 (TRYP1) and tyrosinase-related protein 1 (TRYP2). Which is affecting the cellular differentiation processes [9]. Hair pigmentation is regulated by melanocyte differentiation at the embryonic stage. Kit is able to induce proliferation of melanoblasts in the epidermis by survival signal [10]. SCF and Kit are encoded map to the steel (sl) loci and the dominant white spotting (w) loci, which is a mutation occurs showing unpigmented hairs phenotype in mice [1113]. Kit is almost exclusively expressed in the epidermis [14]. In previous study, mutated white spotting locus is affect various aspects such as defective pigmentation, spotting, ventral spot, diluted coat color, change the eyed color in mouse [15]. Furthermore, murine whitespotting locus mutation affect melanogenesis during development, and ectopic Kitw42 minigene transgenic mice was shown that change the coat color phenotypes [16]. Also, Kit gene mutation is affected the coat colors and patterns in pig [17]. However, overexpressed pig Kit gene is unclear how they are affected on hair pigmentation. The aim of the study was to find out the effect on melanogenesis of skin tissues using ectopic porcine Kit overexpressed transgenic mice.

Materials and Methods

Animals

All mice used in the study were maintained in the Korea Research Institute of Bioscience and Biology (KRIBB) animal facility under pathogen-free conditions in a temperature-controlled climate 63 at 22 ± 2°C and with a 12-h light/dark cycle. All animal experiments were approved by the Institutional Animal Care and Use Committee of KRIBB (approval number: KRIBB-AEC-17103) and were performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the U.S. National Institutes of Health [18-20]. All animals had free access to food and water during the experiments.

Vector cloning

For the convenience of cloning, each of the keratin promoter and porcine Kit gene was synthesized (Cosmo Genetech, Korea) and inserted into the targeting vector. In short, two parts of synthesized keratin and Kit gene was ligated and NLNDTA vector was digested by XhoI (New England Biolabs, USA) and NotI (New England Biolabs) to insert the keratin promoter and Kit gene. The final vector NLDTKeratin promoter-Kit was confirmed by sequencing and linearized by XhoI and NotI used for pronuclear injection.

Generation of TG mouse

Ectopic swine Kit gene expression TG mice were generated linearized NLDT-keratin promoter-Kti plasmid DNA microinjection into mouse zygotes of C57/BL6 strain. We obtained total 87 F0 found mice, then genotyping was carried out by PCR analysis using mice tail genomic DNA. PCR primers were sequence as follows: P1, 5`-CTCTTAAGAGGCCGGGGTGA-3` and P2, 5`- CCGCCTTCATTGGTGCATGTA-3` (primer location: Figure 1A). Genomic DNA PCR was performed for 35 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 75°C for 30 seconds. Transgenic lines were established by breeding ransgenic Kit F0 founder mice with wild-type mice to obtain F1 transgenic mice. Then confirm the construction of Kit F1 transgenic mice using PCR 86 analyses. For functional analyses, skin was excised from 4 month old wild type and transgenic mice.

Reverse transcription PCR (RT-PCR) analysis

RNA was extracted from heart, liver, spleen, lung, kidney, skin and muscle of transgenic and wild type mice by using Trizol reagent (Invitrogen, USA) according to the manufacturer`s protocol. RNA was treated with DNase I and reverse transcribed into cDNA using TOPscript cDNA Synthesis Kit (Enzyomics, Korea). cDNA was synthesis, 5 μg of total RNA incubated 55°C for 60 min and 95°C for 5min. Tissue specific expression of porcine Kit was examined by reverse ranscription PCR. The porcine Kit gene specific primers were as follows: porcine Kit gene forward 5`- TGAAGGCGGTTTAAGCAGT-3` and porcine Kit gene reverse 5`-CTTCGACAGCACGGACTTG-3`. RT-PCR was performed for 35 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds. Expression levels were normalized comparing to the amount of GAPDH mRNA in wild type and transgenic mice.

Quantitative real-time PCR (qRT-PCR) analysis

RNA was extracted from skin tissue and cDNA synthesis, cDNA was used as a template for qRT-PCR amplification in combination with melanocyte development specific primers designed (Table 1). qRT-PCR was duplicated with three samples, respectively, using the QuantiTect SYBR Green PCR Kit (Qiagen, Germany) and a Rotor-Gene Q thermal cycler (Qiagen, Germany). qRT-PCR was performed for 40 cycles of 95°C for 20 seconds, 60°C for 20 seconds, and 72°C for 20 seconds. Expression levels were normalized comparing to the amount of GAPDH mRNA of WT-mice and data were analyzed using the △△Ct method.

Genes Forward sequence Reverse sequence Product size (bp)
PAX3 GGGAACTGGAGGCATGTTTA GTTTTCCGTCCCAGCAATTA 151
SOX10 CCCACACTACACCGACCAG GGCCATAATAGGGTCCTGAGG 143
MITF TACGACAACTCTGGATCTCAC CCTGGCGACACTGATGAC 186
TYR GTACTTGGGAGGTCGTCACC ATCTGCTGAAGATGGGAGCC 202
TRP1 GTGCTTGGAGGTCCGTGTAT CCGCATCAGTGAAAGTGTGC 224
TRP2 CACTGGCAATGAGTCCTTTGC TCCATTACACAGTGTGACCCG 213
GPNMB GGGCATACATTCCCATCTCG AGTGTTGTCCCCAAAGTTCCA 215
PMEL TTCCATTGCCCTGCACTTCC ATACACTGGCTGTCCTCCCC 115
GAPDH TGAAGTCGGTGTGAACGG CGTGAGTGGAGTCATACTGGAA 171

Table 1: Primer sequence for qRT-PCR.

Western blotting analysis

Skin and muscle tissue protein lysates were prepared in RIPA buffer with cocktail of protease inhibitors, and then quantified using BSA Progein Assay Reagent (Bio-Rad, USA). Protein samples were boiled in 4x SDS buffer for 10 min, separated by SDS-PAGE on 8% gel running for 3 hrs and then semi-dry transferred to a PVDF membrane (Millipore, USA) at 200 mA for 2 hrs. After blocking with 5% skim milk in 0.1% TBST for 1 hr, the membranes were incubated with primary antibodies against anti-pig c-Kit/CD117 (1:200 Lsbio, USA) or anti-β actin (1:1000 Cell signaling, USA) overnight at -4°C. After 3 times washing in 0.1% TBST and then membranes were then treated with horseradish peroxidase-conjugated secondary antibodies (antimouse 1:5,000 and anti-rabbit 1:5,000, Santa Cruz, USA) for 2 h. After 3 times washing in 0.1% TBST and immunodetection analysis was accomplished using ECL reagent (GE healthcare, USA). Luminescent densities were measured using LAS-3000 Luminescent Image Analyzer System (Fujifilm, Japan).

Hematoxylin and eosin (H&E) staining

The skin tissue was isolated from WT and TG mice, male and aged 16weeks, and then fixed in 4% formaldehyde for overnight at 4°C, The fixed skin were embedded in paraffin, and then paraffin sections (4 μm) were deparaffinized in xylene and re-hydrated in serial diluted alcohol. The samples were washed in running tap water in 5 min and then, incubated in Mayer’s hematoxylin solution for 1 min and washed in running tap water for 20 min. The samples were moved into a jar filled with eosin solution and incubated 1 min. After dehydration and clearing, the samples were visualized under microscope (Nikon, Japan).

Statistical analysis

All experiments were repeated at least three times and statistical analysis were performed using student`s t-test. P< 0.05 was considered significant. The results are expressed as the mean ± SEM of triplicate independent samples.

Results

Establishment of Kit transgenic mice

The transgene construct for skin tissue expression of porcine Kit gene in a transgenic mouse Structure of keratin promoter and Kit gene CDS is schematically depicted in Figure 1A. Fertilized oocytes were microinjected with transgene construct in pro-nuclei; founder transgenic mice were identified by genomic DNA PCR. The results are shown in the 3 transgenic founder mice (3/7, #1, 6, and 7, Figure 1B). Among them, #3 Kit TG mice shown that low amplification band intensity compared with positive and other transgenic mice. The result may be caused by lower copy number and integration of the foreign porcine Kit gene.

cloning-transgenesis-TG-mouse

Figure 1: Identification of porcine Kit gene TG mouse, (A) The linearized vector, (B) Identification by polymerase chain reaction (PCR)-based genotyping of TG mouse, M (100 bp maker), DL 10,000:1, 1, control (+) KP-KIT-pA vector, 2, control (-) wild type mouse, positive TG mouse objective strap (numbers 3, 6 and 7), negative mouse with no object strap (numbers 4 and 5).

Characterization of porcine Kit transgenic mice

To investigate the expression of Kit gene in various tissue of transgenic mouse, we used porcine specific RT-PCR primers. These results showed that no expression in wild type mice, but porcine Kit gene was expressed in liver and skin tissues (Figure 2A). We constructed skin specific expression using keratin promoter, but additionally observed expression in liver tissue. Finally, we investigated porcine KIT protein expression by western blot. These result showed high protein expression in skin tissues of TG mice, but no protein was detected in muscle tissues (Figure 2B).

cloning-transgenesis-porcine-Kit-gene

Figure 2: Expression of porcine Kit gene in WT and TG mice. (A) Expression of porcine Kit gene in WT mice, (B) Expression of porcine Kit gene in TG mice, RTPCR amplification of heart (lane 1), liver (lane 2), spleen (lane 3), lung (lane 4), kidney (lane 5), skin (lane 6) and muscle (lane 7). Expression levels were normalized by the amount of GAPDH mRNA (C) Western blot analysis on the expression of KIT in skin and muscle tissues compared with WT (-) and TG (+) mice. Expression levels were normalized by the amount of β-actin.

Effect of skin melanogenesis in porcine Kit transgenic mice

To determine the effect of skin tissue melanocyte development of transgenic mice, H&E stained of skin tissue of transgenic mice and wild type. These results showed that no changes in the morphologies and phenotypes (Figure 3). Furthermore, melanogenesis associated gene expression of skin tissue in transgenic mice and wild type (Figure 4). Porcine Kit gene was not affected on melanocyte associated genes.

cloning-transgenesis-skin-tissues

Figure 3: Analysis of H&E stating, (A) WT and (B) TG mice in skin tissues. Scale bar, 50 μm shown in applies to all image.

cloning-transgenesis-melanogenesis

Figure 4: Expression of melanogenesis associated genes in WT and TG mice. These data were normalized by GAPDH, and the error bars represent ± SEM for three independent replicates.

Discussion

In this study, we established porcine Kit gene transgenic mice, and determined the porcine Kit gene involved the melanogenesis. Ectopic porcine Kit gene transgenic mice were scarified within 4 months of age, and then histological and gene expression analysis were performed on the genes associated in skin tissue. We hypothesized that Kit transgenic mice would exhibit a pigmentation of skin tissues. Because it is involved in white spotting colors in European pigs [8]. But we did not observe any obvious effect on the skin tissue alterations. Melanogenesis, the production of melanin pigment is shown responsible for melanin production and distribution [21].

Melanocytes are located in basal layer of hair follicles and skin epidermis [22]. Kit and SCF genes are involved in melanoblast proliferation and skin macules, which mutation can occur to melanoblast development migration (piebaldism) [8]. Kit and Mitf are needed for initial expansion of melanoblast, and also Kit plays in the development of pigment cells by Mitf, a crucial transcription factor. The elimination of expression of the Mitf-M isoform is caused by deafness and depigmentaion in pigs [23]. Also, the duplication of the Kit gene is associated dominant white mutation pigs [10]. In addition, the molecular events of variable pig genes shown that different coat colors such as missense mutation of melanocortin 1 recpetor (MC1R) [24], copy number variation and splice mutation of Kit [25], 6 bp deletion of tyrosinase related protein1 (TRYP1) [26], missense 176 mutation of endothelin receptor beta (EDNRB) [27,28], missense mutations of Kit ligand (KITLG) [29], and missense mutations of oculocutaneous albinism 2 (OCA2) [30].

Conclusion

In conclusion, we established ectopic overexpression of porcine Kit gene in transgenic mice. Porcine Kit gene was only expressed in skin and liver tissue. However, it did not effect on melanocyte development and skin morphology. Further studies on Kit gene will provide insight into other specific roles in hair colors and liver tissue metabolism.

Acknowledgement

This work was carried out with the support of “Next Generation Biogreen 21 (Project No. PJ01104101)” from the Rural Development Administration, Republic of Korea.

Conflict of Interests

The authors declare no competing interests.

References

Citation: Ahn JS, Kim GR, Jang SH, Kim D, Hwang S, et al. (2017) Overexpression of Porcine Kit Gene in Transgenic Mice Does not Affect Melanogenesis. Clon Transgen 6: 159. Doi: 10.4172/2168-9849.1000159

Copyright: © 2017 Ahn JS, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Select your language of interest to view the total content in your interested language

Post Your Comment Citation
Share This Article
Relevant Topics
Recommended Conferences
Article Usage
  • Total views: 624
  • [From(publication date): 0-2017 - May 27, 2018]
  • Breakdown by view type
  • HTML page views: 589
  • PDF downloads: 35

Post your comment

captcha   Reload  Can't read the image? click here to refresh
Leave Your Message 24x7