alexa Polymorphism of the Microsatellite DXS8377 in a Population of Northern Thai Males | Open Access Journals
ISSN: 2157-7145
Journal of Forensic Research
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Polymorphism of the Microsatellite DXS8377 in a Population of Northern Thai Males

Worraanong Leewattanapasuk1*, Asaneepond Kunjae2, Padchanee Sangthong1 and Tanin Bhoopat3

1Department of Chemistry, Faculty of Science, Chiang Mai University, Chiang Mai, Thailand

2Division of Forensic Science,The Graduate School, Chiang Mai University, Chiang Mai, Thailand

3Department of Forensic Medicine, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand

*Corresponding Author:
Worraanong Leewattanapasuk
Department of Chemistry, Faculty of Science
Chiang Mai University
Chiang Mai 50200
Thailand
Tel: 66-53-943341
Fax: 66-53-89-2277
E-mail: [email protected]

Received date: October 24, 2016; Accepted date: December 02, 2016; Published date: December 08, 2016

Citation: Leewattanapasuk W, Kunjae A, Sangthong P, Bhoopat T (2016) Polymorphism of the Microsatellite DXS8377 in a Population of Northern Thai Males. J Forensic Res 7: 357. doi:10.4172/2157-7145.1000357

Copyright: © 2016 Leewattanapasuk W, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Forensic Research

Abstract

Objective: This research investigated the polymorphism of the X-chromosomal short tandem repeats (X-STR) DXS8377 in Northern Thai males. Methods: Genomic DNA was extracted from blood or buccal cells of 200 unrelated healthy individuals using Nucleospin® Blood or Nucleospin® Tissue (Macherey-Nagel), respectively. The DXS8377 locus was amplified by polymerase chain reaction (PCR) and the PCR product was analyzed by agarose gel electrophoresis. The allelic ladder was constructed and the size of all PCR products was analyzed by polyacrylamide gel electrophoresis using allelic ladder as a marker. The nucleotide sequences of the different-sized PCR products were analyzed to identify the DXS8377 alleles. Lastly, the Polymorphic information content (PIC) and Power of discrimination (PD) of DXS8377 DNA marker were calculated and the analysis of population relationships was performed using chi-square test of homogeneity. Results: Eleven DXS8377 alleles were observed in the study population, the allele 49 was the most frequent with the allele frequency of 0.4400. According to previous studies, allele 49 was found in all of the populations studied and it was common among various populations. The polymorphism and the probability of DXS8377 to discriminate two unrelated individuals were moderate with a PIC and PD of 0.6973 and 0.7305, respectively. Most interestingly, the DXS8377 DNA marker was able to differentiate Mongoloid from Caucasoid and Negroid and it was also able to differentiate Northern Thai males from other Asian populations, including Korean, Japanese and Chinese. Conclusion: Even though DXS8377 possessed moderate PIC and PD, this DNA marker was able to differentiate Mongoloid from Caucasoid and Negroid and it was also able to differentiate Northern Thai males from Korean, Japanese and Chinese.

Keywords

X-STR; DXS8377; Northern Thai males; Allele frequency; Polymorphic information content; Power of discrimination; Population relationships

Introduction

Forensic science has been extensively developed especially in the study of population genetics. Because events that are harmful to persons and things happen all the time, forensic evidence that is able to link individual offenders to these events is very important. DNA evidence is reliable and its use recognized internationally. Population genetics investigates gene or allele frequency, both of which represent the genetic composition of a population. In this study, the population genetics of a population of Northern Thai males was evaluated using short tandem repeats (STRs).

Short tandem repeats (STRs) are microsatellites that are abundant throughout the human genome, especially on non-coding regions. STRs are advantageous as genetic markers because they are highly polymorphic and have a wide range of applications in forensic science and casework, including individual identification and the study of relationship between populations. Forensic STR analysis can be performed with biological evidence, such as blood cells, buccal cells and bones [1,2].

STRs can be found on both autosomal and sex chromosomes, including STRs on the Y-chromosome (Y-STRs) and X-chromosome (X-STRs). However, the recombination and mutation rates of STRs on autosome are higher than STRs on sex-chromosome. Therefore, STRs on sex-chromosome are highly useful for individual identification, paternity and kinship testing. Population genetics studies using Y-STRs as genetic markers are numerous, thus providing considerable reference information, whereas, studies of X-STRs are relatively new, although demand for them is increasing [3].

Children inherit X-STRs through both father (paternal inheritance) and mother (maternal inheritance). Male individuals inherit their one X-chromosome from their mothers, while female individuals receive two X-chromosomes — one each from the mother and father. Therefore, X-STRs are useful genetic markers for studying population genetics [4-6].

Athanasiadou et al. [4] developed a quadruplex PCR to analyze four X-STRs, including DXS101, DXS8377, HPRTB and STRX-1 (DXS981) in German population. The results showed that, among the four XSTRs used in their study, DXS8377 was the most polymorphic and the alleles 45 and 48 were found to be the most frequent. In 2005, Tabbada et al. [5] analyzed four X-STRs, including DXS101 HPRTB DXS8377 and DXS981(STRX-1), in Chinese, Japanese and Thais. The results revealed that, similar to the findings of Athanasiadou et al. [4], DXS8377 was the most polymorphic. In 2006, Gomes et al. [7] analyzed four X-STRs, including DXS7423, DXS101, DXS8377and HPRTB in Galician resided in Northern Spain and it was revealed that DXS8377 was the most polymorphic. In 2011, A?icio?lu et al. [8] analyzed five X-STRs, including, DXS8377, DXS101, DXS6789, STRX-1 and HUMHPRTB, in Turkish and DXS8377 was found to be highly polymorphic and possessed high power of discrimination (PD). To summarize the analysis of DXS8377 in various populations, this DNA marker was highly polymorphic and, thus, can be applied in the individual identification and forensic caseworks.

The population relationships were normally employed to analyze the similarities between two different populations [9]. Katsuyama et al. [10] analyzed the genetic relationships of various populations, including Japanese, Northern Han, Hui, Uygur, Kazakh, Greek, Saudi Arabian, and Italian, by using four variable number of tandem repeats (VNTRs; D1S80, D4S43, COL2A1, D17S5) and one STR (ACTBP2) loci. By analyzing the allele frequencies of five genetic markers, it was revealed that these genetic markers can differentiate Asian and European populations. When considering a dendrogram constructed based on the allele frequencies, two clusters were clearly formed, in which five Asian populations (Japanese, Northern Han, Hui, Uygur, and Kazakh) were presented in one cluster, while two Europeans and one West Asian (Italian, Greek, and Saudi Arabian) were presented in another. Gonzalez-Perez et al. [11] analyzed the population relationships in the Mediterranean populations by using the combination of genetic markers; 18 Alu insertion polymorphisms (polymorphisms based on the presence and absence of an Alu element at a specific location of chromosome) and 3 STR loci. The results showed that, when considering the Alu/STR haplotype frequencies, the differentiation between Northern and Southern Mediterraneans was significantly noticeable

The aim of this study was to investigate the polymorphism of X-STR DXS8377 in the population of Northern Thai males. The obtained data can be applied in the analysis of forensic casework, such as deficiency paternity testing and complicated kinship testing. Moreover, as Northern Thailand shares borders with Myanmar and Laos, and immigration for employment is common, the obtained data on DXS8377 in a population of Northern Thai males might be essential should a major incidence occur, like an earthquake that requires individual identification.

Experimental Methods

Population sampling and DNA extraction

DNA was collected from 200 unrelated healthy males, aged between 18-60 years old, and are resided in the North of Thailand (Figure 1). All participants signed informed consent forms. The Ethics Committee of the Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand approved this study (study code No. NONE-2557-02446 (2015). Genomic DNA was extracted from either blood cells or buccal cells using Nucleospin® Blood or Nucleospin® Tissue (Macherey-Nagel, Germany), respectively, according to the manufacturer’s recommendation. The integrity of DNA was analyzed by 1.2% agarose gel electrophoresis.

forensic-research-Geographical-location

Figure 1: Geographical location of the populations used in this study. DNA samples were collected from 200 unrelated healthy individuals residing in the North of Thailand.

DXS8377 amplification

PCR amplification of the DXS8377 STR marker was performed in a 50 μl reaction containing 50 ng to 100 ng of DNA template, 1x PCR buffer, 1.5 mM MgSO4, 0.2 mM of each dNTPs, 0.5 μM of each primer (H-8377-F and H-8377-R primers; nucleotide sequences shown in Table 1) [4] and 1.0 μl of KOD-Plus-Neo DNA polymerase (Toyobo, Japan) using a Mastercycler® Personal thermal cycler (Eppendorf, USA). The STR amplification was cycled through the following PCR program: initial denaturation at 98°C for 10 min, 30 cycles of denaturation at 98°C for 10 sec, primer annealing at 60°C for 10 sec and product extension at 68°C for 20 sec, followed by final extension at 68°C for 10 min. The expected PCR products (225 bp to 264 bp) were examined by 2.5% ethidium bromide stained agarose gel electrophoresis using Low range DNA marker-A (25 bp to 500 bp) (Bio Basic Inc., Canada) as the standard DNA marker.

Construction of allelic ladder

The different-sized PCR products were analyzed by 8.5% polyacrylamide gel electrophoresis (PAGE) using Low range DNA marker-A (25 bp to 500 bp) (Bio Basic Inc., Canada) as the standard DNA marker. Briefly, 1 μl of PCR product was mixed with 1 μl of 6x loading dye (50% v/v Glycerol, 200 mM EDTA pH 8.0, 0.125% w/v Bromophenol blue) and applied to the 8.5% PAGE. After electrophoresis at 120 volts for 2 h, the fragments were separated and detected by silver staining. Briefly, 100 ml of 1% (v/v) nitric acid was added to the gel and agitated for approximately 10 min. Nitric acid (1%) was subsequently discarded and the gel was rinsed with deionized water. Silver nitrate solution (100 ml of 0.012 M) was added to the gel and agitated for approximately 30 min. After 30 min, 0.012 M silver nitrate solution was discarded and the gel was rinsed with deionized water. Sodium carbonate (50 ml of 0.28 M) and 0.019% (v/v) formalin solution were added to the gel; the solution was discarded when it turned from colourless to brown. Sodium carbonate (50 ml of 0.28 M) was repeatedly added to the gel until the DNA fragments were noticeable. Following the appearance of DNA fragments on the gel, 100 ml of 10% (v/v) glacial acetic acid was added to stop the reaction. After approximately 5 min, 10% glacial acetic acid was discarded and the gel was rinsed with deionized water until the acetic acid odour was undetectable.

PCR products of different sizes were selected and the DXS8377 loci of these samples were re-amplified from genomic DNA by PCR using different pairs of primers, H-8377-CF and H-8377-R (nucleotide sequences shown in Table 1). The obtained PCR products were purified from 2.5% ethidium bromide stained agarose gel using NucleoSpin® Gel and PCR clean-up (Macherey-Nagel, Germany). The purified PCR products were used as DNA templates for a second PCR amplification using H-8377-F and H-8377-R primers. Nucleotide sequences of the amplicon obtained from the second PCR amplification were subsequently analyzed by First BASE Laboratories SdnBhd (Malaysia) using a BigDye® Terminator v3.1 cycle sequencing kit. The designation of the DXS8377 allele was based on its complex composition: (AGA)x- (GGA-AGA)y-(AGA)2-GGA-(AGA)6. The total number of repeat units (x+2y+9) was calculated to identify DXS8377 alleles [12].

Primers Nucleotide sequences (5’->3’)
H-8377-CF CCCTTCTGCAACAGTTCTGCC
H-8377-F ACCACTTCATGGCTTACCACAG
H-8377-R TATGGACCTTTGGAAAGCTAG

Table 1: Nucleotide sequences of primer.

Identification of DXS8377 alleles

The X-STR DXS8377 alleles of all samples were identified by comparing the size of the PCR products to the allelic ladder constructed on 8.5% PAGE.

Data analysis

Nucleotide sequences were analyzed and the allele frequencies (Pi) were determined using the equation Pi=(number of allele i)/(total alleles). The polymorphic information content (PIC) was determined using the equation PIC=1-ΣPi 2-(ΣPi 2)2+(ΣPi 2)4, in which Pi is the allele frequency of i. The power of discrimination (PD) was also determined using the equation PD=1-Σ(Pi)2, in which Pi is the frequency of genotype i [13].

The analysis of population relationships were also performed using chi-square test of homogeneity. This test was applied to analyze the similarities between two different populations using the equation Eij=[( RTi)(CTj)]/N, in which Eij is the frequencies expected for population i at level j, RTi is the total observations from population i, CTj is the total observations at treatment level j and N is the total number of sample.

The chi-square test was determined using the equation X2=Σ[(Oij- Eij)2/Eij], in which Oij is the frequencies observed in population i for level j of the categorical variable and Eij is the frequencies expected in population i for level j of the categorical variable. The degree of freedom (df) was determined using the equation df=(r-1)(c-1), in which r is the total number of populations and c is the total number of levels for the categorical variable [9].

Results and Discussions

Designation of DXS8377 allele

Eleven DXS8377 alleles were identified in this study: allele 42 (PCR fragment of 225 bp), allele 43 (228 bp), allele 45 (234 bp), allele 46 (237 bp), allele 47 (240 bp), allele 48 (243 bp), allele 49 (246 bp), allele 50 (249 bp), allele 51 (252 bp), allele 54 (261 bp) and allele 55 (264 bp) as shown in Table 2. According to this study, allele 49 was the most frequent with the allele frequency of 0.4400 and three alleles, including allele 42, 46 and 47, were the least frequent with the allele frequency of 0.0050 (Table 2). The DXS8377 allele distribution in Northern Thai males was presented in Figure 2.

Allele Allele frequency Amplicon length (bp) Nucleotide sequences
42 0.005 225 PF-N31-(AGA)23-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N25-PR
43 0.02 228 PF-N31-(AGA)24-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N25-PR
45 0.01 234 PF-N31-(AGA)24-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N25-PR
46 0.005 237 PF-N31-(AGA)29-(GGA-AGA)4-(AGA)2-GGA-(AGA)6-N25-PR
47 0.005 240 PF-N31-(AGA)26-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N25-PR
48 0.155 243 PF-N31-(AGA)29-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N25-PR
49 0.44 245 PF-N31-(AGA)28-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N25-PR
50 0.145 248 PF-N31-(AGA)31-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N25-PR
51 0.17 251 PF-N31-(AGA)30-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N25-PR
54 0.035 260 PF-N31-(AGA)29-(GGA-AGA)8-(AGA)2-GGA-(AGA)6-N25-PR
55 0.01 264 PF-N31-(AGA)34-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N25-PR
PF: sequence of primer H-8377-F (22 bp)
PR: complementary sequence of primer H-8377-R (21 bp)
N31: CAGCAGAAGAAGAAGAAGCAGCAGCAGCAGC
N25: CAGGGAACGAAGGAACAAAAATACA

Table 2: Allele nomenclature, allele frequency, amplicon length and nucleotide sequences of DXS8377 observed in Northern Thai males.

forensic-research-allele-distribution

Figure 2: The DXS8377 allele distribution in Northern Thai males.

When comparing the results of this research to previous studies that analyzed X-STR DXS8377 in other populations, allele 49 was found in all of the populations studied (Table 3) [4,5,15-21].

Interestingly, allele 49 was common among various populations as it was also the most frequent in Japanese, Xinjiang Uigur and Inner- Mongolia Mongol (China), Korean, German, Italian and Galician (Spain) populations [5,7,15-19] (Table 3 and Figure 3).

Populations Sample size DXS8377 alleles (number of allele) Highest allele frequency PIC PD
Northern Thai males (this study) 200 42-43,45-51, 54-55(11)    49=0.4400 0.6973 0.7305
German [4] 120 37-56        (19) 45,48=0.1390 N/D N/D
Thai [5] 157 40,44-56,58(16) 47=0.1515 N/D M=0.9005/F=0.9817
Japanese [5] 95 42-55,58(15) 49=0.1684 N/D M=0.8971/F=0.9805
Galician (Spain) [7] 68 40-57(17) 46,48,49,50,53=0.0960 N/D N/D
Japanese [15] 401 42-58(17) 49=0.1710 0.889 M=0.8870/F=0.9820
Japanese [16] 546 41-58(18) 49=0.1520 0.9 M=0.9000/F=0.9780
Philippines [5] 155 37,43-55, 57-58 (16) 48=0.1329 N/D M=0.9092/F=0.9846
Chinese [5] 90 40,42-56(16) 47=0.1800 N/D M=0.8876/F=0.9771
Xinjiang Uigur(China) [17] 235 41-58(18) 49=0.1398 0.9101 M=0.9020/F=0.9846
Inner-Mongolia Mongol (China) [17] 209 42-55(14) 49=0.1608 0.8987 M=0.8853/F=0.9814
Korean [18] 300 41-59(19) 49=0.1360 0.897 0.983
Italy (Umbrian, Perugia, Terni) [19] 200 40-56(17) 48,49=0.1184 0.9 0.97
Slovak [20] 116 40-56,58   (18) 48=0.1550 N/D M=0.9100
Belarusian [20] 180 42-57,60   (17) 48=0.1390  N/D M=0.9100
German [5] 105 40-56        (17) 49 = 0.1500 N/D  M=0.9148/F=0.9865

Table 3: Allele frequency, PIC and PD of DXS8377 observed in various populations.

forensic-research-Various-populations

Figure 3: Various populations in which allele 49 of DXS8377 was the most frequent.
TH: Northern Thai males (this study) CN2: Inner-Mongolia Mongol (China) [17]
JP1: Japanese [5] KR: Korean [18]
JP2: Japanese [15] ES: Galician (Spain) [7]
JP3: Japanese [16] IT: Umbrian, Perugia, Terni (Italy) [19]
CN1: Xinjiang Uigur (China) [17] DE: German [5]

In this study, the subordinate allele was allele 51, with an allele frequency of 0.1475 (Table 2 and Figure 2). Previous studies also found allele 51 to be subordinate, including the genetic analysis in populations of Han Chinese, Galicians (Spain) and Slovakians, as shown in Table 3 [7,17,20]. Allele 48 was the third frequent in this study with the allele frequency of 0.1450, as shown in Table 2 and Figure 2. This result is similar to the analysis of DXS8377 in populations of Chinese, Japanese and Inner-Mongolia Mongol (China), in which allele 48 was also the third frequent (Table 3) [5,16,17]. Allele 50 was the fourth frequent in this study with the allele frequency of 0.1200, as shown in Table 2 and Figure 2. This result is similar to the analysis of DXS8377 in Chinese, Japanese and Inner-Mongolia Mongol (China), in which allele 50 was also the fourth frequent (Table 3) [5,15-17]. Interestingly, Tabbada et al. [5] found allele 47 was the most frequent of DXS8377 observed in Thai populations, while in this study, allele 47 was among the least frequent alleles observed in Northern Thai males. However, Tabbada et al. [5] did not mention the regions of Thailand in which they collected the DNA samples.

Statistical analysis of DXS8377

The forensic efficiencies of X-STR DXS8377 in the population of Northern Thai males studied here are presented in Table 3. It was revealed that the polymorphism of this DNA marker is moderate, with a PIC of 0.6973 or 69.73%. The probability of DXS8377 to discriminate two unrelated individuals is moderate, with a PD of 0.7305 (73.05%). Most interestingly, according to the analysis of population relationships, the DXS8377 DNA marker was able to differentiate Mongoloid from Caucasoid and Negroid and it was also able to differentiate Northern Thai males from other Asian populations, including Korean, Japanese and Chinese.

Polymorphic information content (PIC)

The polymorphic information content (PIC) obtained from this study was 0.6973, which was moderate compared to previous studies in Japanese, Xinjiang Uigurs, Inner-Mongolia Mongol, Korean and Italian populations[15-19] (Table 3). According to previous studies, the overall PIC of DXS8377 is high, with the PIC of 0.8890-0.9101, meaning this DNA marker is highly polymorphic. However, the fact that most of the DNA samples used in this study were obtained from Thai male volunteers who resided in Chiang Mai might explain the moderate PIC observed.

Power of discrimination (PD)

The power of discrimination obtained from this study was 0.7305 (Table 3), which was moderate when compared to the analysis of DXS8377 in other populations from previous studies, including Thai, Japanese, Philippines, Chinese, Xinjiang Uigur, Inner-Mongolia Mongol, German, Slovakian, Korean and Italian populations [5,15-20] (Table 3). According to previous studies, the overall PD of DXS8377 is high, with the PD of 0.8853-0.9865, meaning this DNA marker possesses a high probability of discriminating between two unrelated individuals. However, the limited number of alleles identified in the population of Northern Thai males from this study might explain the moderate PD observed.

Population relationships

The analysis of population relationships to examine the similarity between Mongoloid, Caucasoid and Negroid populations using DXS8377 DNA marker revealed that these populations were significantly different at chi-square (X2) of 226.57, (p< 0.0001, df=40). The DXS8377 allele distribution in Mongoloid, Caucasoid and Negroid (Figure 4) [19,21].

forensic-research-Mongoloid-Caucasoid

Figure 4: The DXS8377 allele distribution in Mongoloid, Caucasoid and Negroid.

Furthermore, the analysis of population relationships to examine the similarity between Northern Thai males (this study) and other Asian populations, including Korean, Japanese and Chinese, suggested that Northern Thai males and Korean, Northern Thai males and Japanese and Northern Thai males and Chinese were significantly different at X2 of 111.27 (p< 0.0001, df=16), X2 of 92.976 (p< 0.0001, df=14) and X2 of 87.039 (p< 0.0001, df=14), respectively. The DXS8377 allele distribution in Northern Thai males, Japanese, Chinese and Korean (Figure 5) [5,18]. These results suggested that the X-STR DXS8377 marker was able to differentiate Mongoloid from Caucasoid and Negroid populations. Most interestingly, DXS8377 was able to differentiate Northern Thai males from other Asian populations, including Korean, Japanese and Chinese.

forensic-research-Northern-Thai

Figure 5: The DXS8377 allele distribution in Northern Thai males, Japanese, Chinese and Korean.

To summarize, the analysis of DXS8377 in a population of Northern Thai males in this study revealed that the polymorphism of this DNA marker is moderate, with a PIC of 0.6973, or 69.73%. The probability of DXS8377 to discriminate two unrelated individuals is moderate, with a PD of 0.7305 (73.05%). The fact that most of the DNA samples used in this study were obtained from Northern Thai males who were resided in Chiang Mai, Thailand and the limited number of alleles identified in this study might explain the moderate PIC and PD observed [14]. Interestingly, according to the analysis of population relationships, DXS8377 alleles observed in Mongoloid were significantly different from Caucasoid and Negroid. Moreover, the DXS8377 alleles observed in Northern Thai males were significantly different from other Asian populations, including Korean, Japanese and Chinese.

Conclusion

This study analyzed the polymorphism of DXS8377 in 200 unrelated healthy individuals of Northern Thai males. Eleven DXS8377 alleles were observed in the population examined, of which the PCR products ranged from 225 bp to 264 bp. The PIC and PD of DXS8377 in the population of Northern Thai males were 0.6973 and 0.7305, respectively. DXS8377 alleles observed in Mongoloid were significantly different from Caucasoid and Negroid and the DXS8377 alleles observed in Northern Thai males were significantly different from other Asian populations, including Korean, Japanese and Chinese. Therefore, the DXS8377 DNA marker was able to differentiate Mongoloid from Caucasoid and Negroid and it was also able to differentiate Northern Thai males from Korean, Japanese and Chinese.

Acknowledgments

This research was funded by the Faculty of Science, Chiang Mai University, Chiang Mai, Thailand. We would like to thank all the volunteers for contributing the blood and buccal swab samples for this research.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Recommended Conferences

Article Usage

  • Total views: 873
  • [From(publication date):
    December-2016 - Sep 20, 2017]
  • Breakdown by view type
  • HTML page views : 805
  • PDF downloads :68
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords