alexa Polymorphisms of Cytochrome P450 2E1 Gene and Gastric Cancer Risk: A Case Control Study from West Bengal, India | Open Access Journals
ISSN: 2472-128X
Journal of Clinical & Medical Genomics
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Polymorphisms of Cytochrome P450 2E1 Gene and Gastric Cancer Risk: A Case Control Study from West Bengal, India

Sudakshina G1, Soumee G1, Bankura B1, Sahab ML2, Chinmoy KP3, Chakraborty S1 and Das M1*

1Department of Zoology, University of Calcutta, Kolkata, India

2Department of Surgery, Institute of Post Graduate Medical Education and Research, Kolkata, India

3Department of Oncogene Regulation and Viral Associated Human Cancer, Chittaranjan National Cancer Institute, Kolkata, India

Corresponding Author:
Das M, Department of Zoology
University of Calcutta
35 Ballygunge Circular Road
Kolkata-700019, West Bengal, India
Tel: +91-09831281756
Fax: +91-33-24614849
E-mail: [email protected]

Received date: April 3, 2017; Accepted date: May 5, 2017; Published date: May 13, 2017

Citation: Ghosh S, Ghosh S, Bankura B, Sahab ML, Chinmoy KP, et al. (2017) Polymorphisms of Cytochrome P450 2E1 Gene and Gastric Cancer Risk: A Case Control Study from West Bengal, India. J Clin Med Genomics 5:148. doi:10.4172/2472-128X.1000148

Copyright: © 2017 Sudakshina G, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Clinical & Medical Genomics

Abstract

Background: RsaI/PstI and DraI polymorphisms of cytochrome P450 2E1 (CYP2E1) gene are regarded as the most common polymorphisms associated with gastric cancer (GC). Very few data of these polymorphisms have been reported from India with regard to GC risk. We evaluated RsaI: -C1053T (rs2031920), PstI: -G1295C (rs3813867) site in the 5’ flanking region, DraI: T7668A (rs6413432) site in intron 6, -G71T rs6413420 and G4768A or V179I rs6413419 polymorphisms of CYP2E1 with GC risk in the population of West Bengal, India. Methods: We enrolled 105 GC patients (cases) and corresponding sex, age and ethnicity matched normal 108 individuals (controls) for the study. Genotyping for rs6413419, rs6413420, rs6413432, rs2031920, rs3813867 of CYP2E1 was performed using DNA sequencing and RFLP analysis. Results and conclusion: Our results suggest that the difference between genotype frequencies of rs3813867 and rs2031920, although not statistically significant but the allele frequencies of rs3813867 (OR=2.29, 95% CI=1.01-5.18, p=0.042) and rs2031920 (OR=2.29, 95% CI=1.01-5.18, p=0.042) showed significant difference between GC and control individuals. This when pooled with smoking augmented GC risk by nearly 4-fold. Therefore, a larger population is needed to be screened to confirm the association of these studied SNPs with GC in India.

Keywords

Gastric cancer; Cytochrome P4502E1; SNPs

Introduction

Gastric cancer (GC) is one of the most common cancers of the gastrointestinal (GI) tract. It accounts for nearly 8% of the total cancer cases and results in 10% of the overall cancer related deaths. More than 70% of new cases of GC are reported to occur in the developing countries [1]. Although the exact mechanisms of gastric carcinogenesis are still unknown, yet it has been hypothesized to be caused by the interplay of both environmental and genetic factors which differs among different ethnic groups, gender, age and habitual behaviours [2-5]. Earlier epidemiological studies showed the role of smoking, drinking and H pylori infection towards the development of GC [6,7]. However, only a small section of the people exposed to these environmental factors develops GC in the long run, which is indicative of the fact that host genetic factors may also play critical role in gastric carcinogenesis. Polymorphisms of several genes associated with GC risk have been identified worldwide. Of them, cytochrome P4502E1 (CYP2E1) gene encoding the metabolizing enzyme CYP2E1 has been of much importance. It is responsible for the metabolic activation of various carcinogens, such as benzene, vinyl chloride and Ndimethylnitrosamines and hence related to cancer threat [8-10]. The activity of this ethanol-inducible enzyme varies with several single nucleotide polymorphisms (SNPs) in the gene encoding this enzyme. For instance, RsaI/PstI polymorphisms, which are in complete linkage disequilibrium (LD), in the 5’-flanking promoter region of CYP2E1 are reported to affect its transcriptional activation [11]. However, the results are controversial. In contrast, the DraI polymorphisms have been found to be associated with only enhanced transcription [12]. RsaI/PstI and DraI polymorphisms are regarded as the most common and influential polymorphisms in CYP2E1 [12] and have been studied with various cancer risks [13-17]. But how the genetic variations of CYP2E1 can elevate the GC risk remains elusive. Moreover, to the best of our knowledge till date, very few data of this gene with regard to GC risk has been reported from India. Thus, our study was aimed to find out the association of CYP2E1 polymorphisms (rs6413419, rs6413420, rs6413432, rs2031920, rs3813867) with GC risk in the population of West Bengal, India.

Subjects and Methods

Patients and control samples

One hundred and five GC cases were recruited from the Department of Surgery, Institute of Post Graduate Medical Education and Research (IPGME and R), Kolkata, West Bengal, India from December 1, 2012 to April 30, 2015. All the individuals enrolled in our study were Bengali. Patients who were newly diagnosed with GC without any other chronic disease and histopathologically confirmed were included. According to histology, the gradations of tumour tissue samples were done using Lauren’s classification [18]. One hundred and eight age, sex and ethnicity matched healthy control subjects who neither had cancer nor any familial history of neoplasms were selected from the same geographical region and socioeconomic status. Their non-cancer status was confirmed by medical examinations including radiographic examinations. Ethical approval for this study was given by the institutional ethics committee of Institute of Post Graduate Medical Education and Research (IPGME and R), Kolkata, West Bengal, India. A signed informed consent was taken from each of the participants. Each individual participating in the study was interviewed for their life style, socio-demographic characteristics, family history of cancer or any other chronic diseases, habitual behaviors like smoking, drinking and dietary habits and physical activity.

Body mass index (BMI)

Height and weight were measured in both patients and controls wearing light clothing and no shoes, to the nearest 0.1 cm and 0.1 Kg, respectively. BMI was calculated with the standard formula: BMI=Weight (kg)/Height (m)2.

Blood collection and DNA extraction

Whole blood (~5 mL) samples were taken from all subjects and collected in separate tubes (contain EDTA, 0.5 M). Genomic DNA was extracted using the DNA extraction kit (QIAamp Blood Kit, QIAGEN, Hilden, Germany) according to the manufacture’s instruction.

PCR analysis and direct sequencing

Five SNPS (rs6413419, rs6413420, rs6413432, rs2031920, rs3813867) of CYP2E1 gene were amplified using specific primers by polymerase chain reaction (PCR). The primers used for each of the amplifications were described in Table 1. PCR amplification was done in a 30 μl volume containing 100 ng of DNA, 0.5 μM of each primer, 0.2 mM of deoxyribonucleotide triphosphate mix, (Invitrogen Carlsbad, CA, USA), 1.5 mM magnesium chloride, 1x buffer and 2.5 Unit Taq Polymerase (Invitrogen). PCR conditions were as follows: denaturation at 94°C for 3 min followed by 44 cycles of denaturation for 30 s, annealing at 58°C-60°C for 30 s, extension at 72°C for 45 s and final extension at 72°C for 5 min. PCR products were subjected to direct DNA sequencing. For rs6413419 and rs6413420, forward and reverse strand sequencing was carried out using the big dye terminator kit (Applied Biosystems, Foster City, CA, USA) on an automated DNA capillary sequencer (Model 3700; Applied Biosystems).

SNPs (rs number) Sequence (5’          3’)
F: Forward
R: Reverse
Digestion pieces (restriction enzyme) Amplicon Length
rs6413419 F: CTCAAACAGGTTCAGACATTCAC
R: GTTGATGACTGATGAAAGAGGAAAG
  347 bp
rs6413420 F: AACATGTTCCTGGATGTGTTTG
R: ATGATGGGAAGCGGGAAAG
  421 bp
rs6413432 F: AGGCTCGTCAGTTCCTGAAAG
R: TTCCATGGTTCCCCTAGTGC
Allele T: 867
Allele A:559, 308 (Dra1)
867 bp
rs3813867rs2031920 F:CCAGTCGAGTCTACATTGTCA
R:TTCATTCTGTCTTCTAACTGG
Allele C: 500
Allele G: 114, 299 (PstI)
413 bp
Allele T:
Allele C: 353,60 (RsaI)

Table 1: Primer sequences and restriction enzymes used for detection of CYP2E1 gene polymorphisms.

RFLP analysis

PCR amplified products were digested using DraI (rs6413432), PstI (rs3813867) and RsaI (rs2031920) enzymes according to the manufacturer’s instructions (New England Biolabs Inc.). Fragments were separated and analyzed by 2.5% agarose gel electrophoresis. Samples of five randomly selected subjects were analyzed twice by direct DNA sequencing to assess the consistency of the genotyping protocol.

Statistical analysis

For each SNP, the genotypic data were analyzed by using multivariate logistic regression model. The demographic variables and life style habits (smoking and alcohol consumption) between cases and controls were compared by t-tests (for continues variables) and chisquare tests (for categorical variables). Hardy-Weinberg equilibrium of each SNP was examined using a χ2 test. Next, unconditional logistic regression model was used to evaluate the risk of GC with regard to smoking status, alcohol consumption and BMI. All the tests were done using GraphPad InStat software (GraphPad InStat software, San Diego, CA) and SNPassoc version 1.81 software (Catalan Institute of Oncology, Barcelona, Spain). Linkage disequilibrium (LD) pattern was analyzed using Haploview 4.2.

Results

Characteristics of study participants

The study was performed with 105 GC patients (78% males and 22% females) having mean age of 55.43 ± 10.86 years (range 22–80 years). There was a male predominance of GC frequency compared to females. Based on the anatomical location, 98% of the patients had non-cardia and only 2% had cardia type of GC. Histology revealed the sample population to be of 49% intestinal, 23% diffuse and 28 % indeterminate type. Smoking (OR=2.45, 95% CI=1.41-4.26, p=0.001) and alcohol consumption (OR=2.77, 95% CI=1.52-5.06, p=0.001) varied significantly between cases and controls where both were found to independently increase the risk of GC. Only 20% of the cases were H. pylori positive and familial cluster for GC occurrence was not observed in our study Table 2.

Characteristics Control (n=108) Case (n=105) Odds ratio (95% CI) p value
*Age (years ± SD) 53.64 ± 7.88 55.43 ± 10.86   0.169
Sex  
Male 89 82    
Female 19 23   0.429
*BMI (kg/m2) 23.28 ± 1.97 20.55 ± 2.75   <0.001
Anatomical location  
Cardia - 3    
Non-cardia - 102    
Histological subtypes of tumour  
Intestinal - 52    
Diffuse - 24    
Indeterminate - 29    
Alcohol consumption  
No 85 60    
Ever 23 45 2.77 (1.52-5.06) 0.001
Cigarette/bidi smoking  
No 66 41    
Ever 42 64 2.45 (1.41-4.26) 0.001

Table 2: Clinical characteristics of gastric cancer patients and controls, *At diagnosis.

Out of the 5 SNPs studied, rs3813867 and rs2031920 were found to be strongly in LD Figure 1, as has been reported in other studies of the world population.

clinical-medical-genomics-disequilibrium

Figure 1: Linkage disequilibrium (LD) pattern (r2) of the five SNPs in CYP2E1 gene in case and control groups. The LD between the SNPs is measured as r2 and shown in the diamond at the intersection of the diagonals from each SNP. r2=0 is shown as white, 0<r2<1 is shown in gray and r2=1 is shown in black.

There were no significant differences between GC and controls in the distribution of either allelic or genotype frequencies of rs6413419, rs6413420 and rs6413432 Table 3.

Genotype Controls (n-108) n (%) Cases (n-105) n (%) OR* (95% CI)  p-value
CYP2E1
rs6413419
GG
GA
AA
G allele
A allele
 106 (98.1)
2 (1.9)
0 (0)
99%
1%
 102 (97.1)
3 (2.9)
0 (0)
99%
1%
 1.00
1.56[0.26-9.52]1.00
1.00 [0.15-6.75]
  0.628 1.00
CYP2E1
rs6413420
GG
GT
TT
G allele
T allele
 102 (94.4)
6 (5.6)
0 (0)
97%
3%
 97 (92.4)
8 (7.6)
0 (0)
96%
4%
 1.00
1.40[0.47-4.19]
--
1.00
1.40 [0.49-4.01]
  0.741 0.730
CYP2E1
rs6413432
TT
TA
AA
TT
TA+AA
T allele
A allele
 78 (72.2)
30 (27.8)
0 (0)
78 (72.2)
30 (27.8)
87%
13%
 72 (68.5)
32 (30.5)
1 (1)
72 (68.5)
33 (31.5)
84%
16%
 1.00
1.16 [0.64-2.09]
--
1.00
1.27 [0.71-2.38]
1.00
1.30 [0.74-2.29]
  0.743 0.6020.436
CYP2E1
rs3813867
GG
GC
CC
G allele
C allele
 99 (91.6)
9 (8.4)
0 (0)
96%
4%
 87 (82.8)
18 (17.2)
0 (0)
91%
9%
 1.00
2.28 [0.97-5.33]
--
1.00
2.29 [1.01-5.18]
  0.053 0.042
CYP2E1
rs2031920
CC
CT
TT
C allele
T allele
 99 (91.6)
9 (8.4)
0 (0)
96%
4%
 87 (82.8)
18 (17.2)
0 (0)
91%
9%
 1.00
2.28 [0.97-5.33]
--
1.00
2.29 [1.01-5.18]
  0.053 0.042

Table 3: Genotype and allele frequencies of CYP2E1 and association with gastric cancer risk, *Odds ratio were adjusted for age, sex, BMI, alcohol and smoking status.

However, only the allele frequencies of rs3813867 (PstI) (OR=2.29, 95% CI=1.01-5.18, p=0.042) and rs2031920 (RsaI) (OR=2.29, 95% CI=1.01-5.18, p=0.042) showed significant difference between GC and control individuals Table 3 and Figure 2.

clinical-medical-genomics-Chromatogram

Figure 2: Chromatogram showing the RsaI (a) and PstI (b) heterozygotes

A stratification analysis was conducted to evaluate the effects of interaction of PstI/RsaI with the risk of GC according to smoking status, alcohol consumption status and BMI. The difference between genotype frequencies of rs3813867 and rs2031920, although not statistically significant, yet individuals having C and T alleles respectively who were smokers had nearly 4-fold risk of GC (OR=3.98, 95% CI=1.07-14.73) Table 4.

  Exposure Status Genotypes Control (n-108) Case
(n-105)
OR (95% CI)* P value
rs3813867
(PstI)
Smoking Non-smoker GG
GC
60
6
38
3
Reference:
0.79 (0.19-3.35)
 0.748
Smoker GG
GC
39
3
49
15
Reference:
3.98 (1.07-14.73)
 0.019
Alcohol Non-alcoholic GG
GC
80
5
59
3
Reference:
0.86 (0.20-3.76)
 0.844
Alcoholic GG
GC
19
4
28
15
Reference:
2.54 (0.73-8.86)
 0.135
Smoking+Alcohol Both non-smoker and non-alcoholic GG
GC
64
2
35
2
Reference:
1.83 (0.25-13.55)
 0.549
Both smoker and alcoholic GG
GC
19
4
25
11
Reference:
2.09 (0.58-7.60)
 0.257
BMI <22 GG
GC
23
4
53
14
Reference:
1.79 (0.22-14.79)
 0.587
rs2031920
RsaI
Smoking Non-smoker CC
CT
60
6
38
3
Reference:
0.79 ( 0.19-3.35)
 0.748
Smoker CC
CT
39
3
49
15
Reference:
3.98 (1.07-14.73)
 0.019
Alcohol Non-alcoholic CC
CT
80
5
59
3
Reference:
0.86 (0.20-3.76)
 0.844
Alcoholic CC
CT
19
4
28
15
Reference:
2.54 (0.73-8.86)
 0.135
Smoking+Alcohol Both non-smoker and non-alcoholic CC
CT
64
2
35
2
Reference:
1.83 (0.25-13.55)
 0.549
Both smoker and alcoholic CC
CT
19
4
25
11
Reference:
2.09 (0.58-7.60)
 0.257
BMI <22 CC
CT
23
4
53
14
Reference:
1.79 (0.22-14.79)
 0.587

Table 4: Interaction between CYP2E1 rs3813867, rs2031920 polymorphisms and smoking and alcohol consumption in gastric cancer, *Odds ratio were adjusted for age, sex, BMI, alcohol and smoking status.

Discussion

The genes that encode the CYP family of enzymes are highly polymorphic and thus lead to inter individual variation in enzyme activity. The activation of various carcinogens like polycyclic aromatic hydrocarbons, nitrosamines and heterocyclic amines involves the active role of these enzymes. An increased risk of GC associated with CYP2E1 polymorphisms that can modify the effects of environmental factors have now been confirmed in many populations throughout the world i.e. Korean [19,20], Chinese [21] and Taiwanese [22]. This enzyme also reduces oxygen molecule to highly active form, which is carcinogenic, and may lead to cancer development [23]. Previous research showed that CYP2E1 gene polymorphisms may be a cause of development of GC [24-29]. The most widely studied SNPs of CYP2E1 are RsaI: -C1053T (rs2031920), PstI -G1295C (rs3813867) site in the 5’ flanking region, DraI: T7668A (rs6413432) site in intron 6, -G 71T rs6413420 and G4768A or V179I rs6413419 [30-33]. The present study was aimed to find out the association between these five most studied SNPs of CYP2E1 and GC incidence in the population of West Bengal, India. We screened 105 GC patients and 108 normal individuals for the study. RsaI/PstI and DraI polymorphisms are regarded as the most frequent and powerful polymorphisms in CYP2E1 that are considered to enhance transcription [12]. Our results suggest that the difference between genotype frequencies of rs3813867 and rs2031920, although not statistically significant but the allele frequencies of rs3813867 (OR=2.29, 95% CI=1.01-5.18, p=0.042) and rs2031920 (OR=2.29, 95% CI=1.01-5.18, p=0.042) showed significant difference between GC and control individuals. It was also found to interact with smoking thereby increasing the risk of GC by nearly 4- fold. However, a study in India from the north eastern state of Mizoram found no association of RsaI polymorphism with GC risk [33]. We found no significant association of SNPs rs6413419 and rs6413420 with GC in our study. Similar results were also observed for oral cancer susceptibility in South Indians [12]. Interestingly, in their study, V179I rs6413419 locus was monomorphic which was different from our finding where we obtained heterozygotes in both case and control population. In another study, CYP2E1 polymorphism and a history of habitual drinking were shown to increase the risk of intestinal-type GC [34]. In India, the incidence of GC varies across different registries. A higher incidence has been reported in the South compared to the North. The highest rate of GC cases is reported from the North Eastern state of Mizoram [35]. But the same being comparatively low in the state of West Bengal, the sample size of this study was limited. Therefore, a larger population is needed to be screened to validate these findings.

Conclusion

We conducted the first study of association between CYP2E1 polymorphisms and the risk of GC from West Bengal, India. Our results suggest that the difference between genotype frequencies of rs3813867 and rs2031920, although not statistically significant but the allele frequencies of rs3813867 and rs2031920 showed significant difference between GC and control individuals. This when combined with smoking increased the risk of GC by nearly 4-fold. However, study with larger sample may contribute to a better understanding towards the association of GC with the studied SNPs.

Conflict of Interest

We have no conflict of interest to declare.

Acknowledgement

We are indebted to the volunteers who participated in this study. This work was supported by CSIR fellowship from the Council of Scientific and Industrial Research (CSIR), Government of India [09/028(0891)/2012-EMR-1 DATE-20.12.2012] to Sudakshina Ghosh and the DBT-Twinning Project on Gastric Cancer [BT/360/NE/TBP/ 2012 dated-25.03.2013] sponsored by the Department of Biotechnology (DBT), New Delhi, Govt. of India.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 243
  • [From(publication date):
    June-2017 - Nov 24, 2017]
  • Breakdown by view type
  • HTML page views : 201
  • PDF downloads : 42
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]m

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords