alexa
Reach Us +441414719275
Prevalence of Four Common Bee RNA Viruses in Eastern Bee Populations in Yunnan Province, China | OMICS International
ISSN: 2157-7579
Journal of Veterinary Science & Technology

Like us on:

Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Prevalence of Four Common Bee RNA Viruses in Eastern Bee Populations in Yunnan Province, China

Miao Wang1, Junlong Bi2,3, Lei Wang1,3, Danyin Zhou1, Xiaotian Ma1, Wengui Li2, Wenzheng Zhao1, Gefen Yin2, Jianping Liu2,4*, Shaoyu He1*

1Eastern Bee Research Institute, Yunnan Agricultural University, Kunming 650201, China

2College of Animal Science and Technology, Yunnan Agricultural University, Kunming 650201, China

3Chuxiong Prefecture Animal Disease Control Center, Chuxiong 675000, Yunnan Province, China

4Karolinska Institute, Department of Biosciences and Nutrition, SE-14183 Huddinge, Sweden

*Corresponding Author:
Jianping Liu
Karolinska Institute
Department of Biosciences and Nutrition
SE-14183 Huddinge, Sweden
Tel: 858586658
E-mail: [email protected]

Shaoyu He
Eastern Bee Research Institute
Yunnan Agricultural University
Kunming 650201, China
E-mail: [email protected]

Received date: December 17, 2015; Accepted date: January 11, 2016; Published date: January 13, 2016

Citation: Wang M, Bi J, Wang L, Zhou D, Ma X, et al. (2016) Prevalence of Four Common Bee RNA Viruses in Eastern Bee Populations in Yunnan Province, China. J Veterinar Sci Technol 7:284. doi:10.4172/2157-7579.1000284

Copyright: © 2016 Liu J, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Veterinary Science & Technology

Abstract

Deformed wing virus (DWV), black queen cell virus (BQCV), sacbrood virus (SBV), Kashmir bee virus (KBV), acute bee paralysis virus (ABPV) and chronic bee paralysis virus (CBPV) are the most common RNA viruses in bee population worldwide. To determine the prevalence of these viruses in Apis cerana in Yunnan Province, China, 270 adult Eastern worker bee (A. cerana) samples have been collected from nine major bee breeding regions in Yunnan province for screening. Our data showed that BQCV, DWV, KBV and SBV are widely prevalent in Yunnan Province. The total prevalence rates of KBV, DWV, SBV and BQCV in Yunnan province were 3%, 14.8%, 24.1% and 36.3%, respectively. BQCV was detected in all selected regions except Jinghong City. The prevalence of KBV in Tengchong County is the first evidence, to our knowledge, showing that Eastern bees could be infected by KBV. The highest infection rate of SBV was found in Kunming city (56.7%). Sequence analysis demonstrated high nucleotide homology between the isolated BQCV, DWV, KBV and SBV strains. Phylogenetic analysis showed that except SBV (YNO7), Yunnan isolates can be likely clustered into independent branches, which indicates the possibility of geographic origins.

Keywords

Black queen cell virus; Deformed wing virus; Kashmir bee virus; Sacbrood virus; Apis cerana; Prevalence; Yunnan

Introduction

The Eastern bee (Apis cerana) has unique biological and behavioral characteristics, playing unique and important roles during the pollination of plants [1]. Located in the far southwest in China, bordering Myanmar, Laos, and Vietnam, Yunnan is the most biologically and culturally diverse province. This province contains snow-capped mountains and true tropical environment, thus supporting an unusually full spectrum of species and vegetation types. Among multitudinous plant species, 148 are honey plants, and 75 of them are used for producing commercial honey [2]. As a result, bee products from Yunnan province rank as the third largest production in China.

Bee colonies have been continually declining worldwide over the past 50 years, the reasons for which have often been linked to the spread of the parasitic mite Varroa destructor and its interaction with certain bee viruses [3]. Both the European bees and the Asian bees are susceptible to a variety of viruses and some other pathogens. At least 18 viruses have been globally identified in different stages and castes of bees including eggs, larvae, pupae, adult workers, drones, and queens [4]. Six of these, i.e., deformed wing virus (DWV), black queen cell virus (BQCV), sacbrood virus (SBV), Kashmir bee virus (KBV), acute bee paralysis virus (ABPV) and chronic bee paralysis virus (CBPV), are the most common ribonucleic acid (RNA) viruses [5,6]. Like most insect-infecting RNA viruses, bee viruses usually persist in unapparent, asymptomatic infections, capable of replicating rapidly under certain conditions, which results in observable symptoms often leading to colony losses. Infection or co-infection with these viruses has been reported in the United States, Britain, France, Italy, Denmark, Japan and Thailand [5].

In the beginning of the 20th century, due to the lack of strict quarantine regulations, foulbrood in bees from Europe was transmitted to China which accompanied the introduction of the Western bee (Apis mellifera). Eastern bees were consequently infected and spread across China, causing huge losses to the bee keeping industry. In recent years, more and more Western bees have been introduced. The rising contact frequency between Western and Eastern bees has deteriorated the risk for the transmission of bee diseases. However, the prevalence state of the six most common RNA viruses in Eastern bees from Yunnan province is still unknown. In this study, we aim to investigate the prevalence of these six viruses in Eastern bees from nine major bee breeding regions of Yunnan province in China.

Material and Methods

Sample collection

Available beekeepers within the nine main beekeeping regions (Kunming City, Luoping County of Qujing prefecture, Mengzi City and Hekou County of Honghe autonomy prefecture, Jinghong City of Xishuangbanna autonomy prefecture, Wuding County and Dayao County of Chuxiong autonomy prefecture, Tengchong County of Baoshan prefecture, and Deqin County of Diqing autonomy prefecture) in Yunnan province were selected for sampling, according to the previously described method [7]. In each region, thirty single adult worker bees without displaying any pathological symptoms were randomly collected from a single colony in the hive in March 2010. All the two hundred and seventy bee samples were preserved in individual microcentrifuge tubes (one bee in one tube) in liquid nitrogen, brought back to the laboratory and stored in –80°C for further analysis.

Primers

Based on sequence alignment, primers for DWV, SBV, CBPV, and ABPV were designed using Primier 5.0 (Premier Biosoft International, CA, USA). Primers for BQCV and KBV were selected from the literature [8]. All primers were synthesized by Sangon Biotech Co, Ltd (Shanghai, China) and listed in Table 1.

Primer Primer Sequence (5’-3’) Position Reference sequence Size of the amplicon(bp) Corresponding gene
DWV-F TCCATCAGGTTCTCCRATAAC 9256-9276 AJ489744 327 polyprotein
DWV-R GCCACAGGTCTAGTTGGATG 9563-9582
SBV-F TCGGATCCACCAAGTTGGAGG 291-311 AF092924 349 polyprotein
SBV-R ACCTCATCACTCTGGGTCCTT 619-639
BQCV-F TGGTCAGCTCCCACTACCTTAAAC 7850-7873 AF183905 700 Structural polyprotein
BQCV-R GCAACAAGAAGAAACGTAAACCAC 8527-8550
KBV-F GATGAACGTCGACCTATTGA 5406-5424 AY275710 415 RdRp
KBV-R TGTGGGTTGGCTATGAGTCA 5801-5819
ABPV-F TTATGTGTCCAGAGACTGTATCCA 8460-8483 AF150629 901 polyprotein
ABPV-R GCTCCTATTGCTCGGTTTTTCGGT 9337-9360
CBPV-F CTTGGATCCGATTTCGCTC 55-73 AF375659 384 RdRp
CBPV-R GAGGTTGTACTCGACCTGAT 419-438

Table 1: Primers used in this study. F: forward, R: reverse.

RNA extraction

Individual adult worker bee sample was minced in liquid nitrogen and homogenized in Trizol (Invitrogen, California, USA). The total RNA for each sample was extracted following the manufacturer’s protocol and dissolved in diethyl pyrocarbonate-treated water in the presence of an RNase inhibitor (Invitrogen). The concentration of total RNA was determined by measuring the absorption at 260 nm, and the purity of RNA was estimated by the absorbance ratio of 260 nm/280 nm using a spectrophotometer. The RNA samples were stored at –80°C prior to molecular detection of viruses.

RT-PCR detection

Using a one-step PCR kit (Takara Biotechnology Co Ltd, Dalian, China), PCR amplification conditions were optimized and finalized. The 25 µl reaction contains template 1 μl, MgCl2 (25 mM) 5 μl, 10 × One Step RNA PCR Buffer 2.5 μl, dNTP mixture (each 10 mM) 2.5 μl, RNase Inhibitor (40 U/μl) 0.5 μl, AMV RTase XL (5 U/μl) 0.5 μl, AMV-Optimized Taq (5 U/μl) 0.5ul, RNase free dH2O 10.5 μl, forward primer and reverse primer 1 μl for each. The conditions are as follow: reverse transcription at 50°C for 30 minutes, denaturation at 94°C for 2 minutes, then 35 cycles of denaturation for 30 seconds at 94°C, annealing for 30 seconds to corresponding optimal temperature (55°C for SBV, 54°C for BQCV, 53°C for DWV, KBV, and ABPV, and 56 °C for CPBV) and 1 minute elongation at 72°C.

Sequencing and phylogenetic analysis

The PCR amplification products were excised from the agarose gel and extracted using a PCR product purification kit (BioTeke Corporation, Beijing, China) and ligated into pMD18-T vectors (Takara Biotechnology Co Ltd). The plasmids were then used to transform EscherichiaColi DH5α cells (Takara Biotechnology Co Ltd). The plasmids were extracted and the inserts were sequenced by Sangon Biotech Co, Ltd. The nucleotide sequence similarities between isolated sequences for each virus were calculated using Lasergene sequence analysis tools MegAlign (DNASTAR Inc, Madison, USA). Phylogenetic and molecular evolutionary genetics analyses were conducted using the neighbor-joining method with MEGA 4 (Temple, AZ, USA) [9]. Numbers at nodes correspond to bootstrap percentages with values of greater than 50 percent being regarded as phylogenetic grouping. Forty-four related reference strains were used as references in the analysis (Table 2).

Viruses Strain name Accession No. Isolation source Country Isolation/
submitted date
DWV unknown AJ489744 Apismellifera Italy June 2002
unknown AY224602 Apismellifera France Jan 2003
PA AY292384 Apismellifera USA May 2003
AUSTRIA-1 DQ224278 Apismellifera Austria Jan 2007
Warwick-2009 GU109335 Apismellifera UK Oct 2009
VDV-1-DWV-No-5 HM067437 Apismellifera UK May 2009
VDV-1-DWV-No-9 HM067438 Apismellifera UK May 2009
Warwick HM162356 Apismellifera UK May 2009
Zriffin JF440526 Zriffin Apiary Israel Oct-2008
Chilensis A1 JQ413340 Apismellifera Chile Oct-2011
SBV Austria AF284617 Apismellifera Austria July 2000
Germany 1 AF284618 Apismellifera Austria July 2000
Rothamstead AF092924 Apismellifera UK Sep 1998
Riez2002 AY152711 Apismellifera France Sep 2002
Sophia1 R80 AY152712 Apismellifera France Sep 2002
AFSSA P12 2002 AY230517 Apismellifera France Feb 2003
CSBV-LN HM237361 Apiscerana China Jan 2009
Korea HQ322114 Apiscerana South Korea Aug-2010
AmSBV-Kor21 JQ390591 Apismellifera South Korea 2011
CQ1 JQ796779 Apiscerana China March 2012
Pennsylvania AY626247 Apismellifera USA May 2004
T73/05A EF570887 Apismellifera Denmark Apr 2007
South African AF183905 Apismellifera South African Sep 1999
Pennsylvania AY626246 Apismellifera USA May 2004
BQCV 1 DQ364629 Apismellifera Uruguay Jan 2006
POLAND-4 EF517519 Apismellifera Poland Mar 2007
D6 EU292211 Apismellifera Brazil Nov 2007
CJ3 EU375537 unknown South Korea Nov 2007
B1 FJ603458 unknown South Korea Dec 2008
R4LY 51 GU903461 Apismellifera UK Feb 2010
20W1-PA-USA-2006 HQ655459 Apismellifera USA Nov 2006
Kor1-BQCV2 JN542438 Apiscerana South Korea Aug 2011
YY1 JX149518 Apismellifera South Korea Jun 2012
KBV Canadian AF034542 Apismellifera USA Nov 1999
unknown AF035359 Apismellifera USA Nov 2000
unknown AF052567 Varroajacobsoni USA Nov 2001
941227B-1 AF085478 Varroajacobsoni USA Nov 1999
mfb6 AF135861 Apismellifera USA Mar 1999
990806B-13 AF197906 unknown Russia Nov 1999
BALL-BRL9apv AF233366 Apismellifera USA Feb 2000
unknown AY787143 Apismellifera Germany Oct 2004
Varroa AY821562 unknown Spain Nov 2004
JAK3 FJ225118 Apiscerana Jordan 2007
KBV_3_TW GU108224 Apiscerana China (Taiwan) 2008

Table 2: Reference sequences used in the phylogenetic analysis.

Results

RT-PCR detection

The prevalence of these six common bee RNA viruses in Eastern bee populations in Yunnan Province was summarized in Figure 1. For BQCV, we identified 20 positive samples in Kunming City (66.7%), 24 in Luoping County (80.0%), 16 in Mengzi City (53.3%), 15 in Wuding County (50.0%), 12 in Dayao County (40.0%), 2 in Tengchong County (6.7%), 8 in Deqin County (26.7%) and 1 in Hekou County (3.3%), with the total prevalence rate 36.3% (98/270). For DWV, 17, 12, 3, 2, and 2 positive bee samples were found in Kunming city (76.7%), Luoping County (40.0%), Wuding County (10.0%), Deqin County (6.7%) and Dayao County (6.7%), respectively. The overall prevalence rate of DWV was 14.8% (40/270). For KBV, 8 of 30 samples (26.7%) collected in Tengchong County were positive, with the other eight regions negative, and the overall total rate in Yunnan province was 3.0% (8/270). For SBV, 17 positive samples in Kunming City (56.7%), 9 in Luoping County (30.0%), 7 in Mengzi City (23.3%), 12 in Jinghong city (40.0%), 9 in Wuding County (30.0%) and 11 in Dayao County (36.7%) were detected, with a total prevalence rate of 24.1% (65/270). Primers for ABPV and CBPV did not reveal any positive samples in this study.

veterinary-science-technology-Eastern-bee-colonies

Figure 1: Prevalence of DWV, SBV, KBV and BQCV in Eastern bee colonies in Yunnan Province.

Sequence and phylogenetic analysis

After alignment, the viruses sharing the same sequences were considered as the same strains. In total, 12 BQCV, 8 DWV, 8 KBV, and 8 SBV strains were identified from the two hundred and seventy bee samples, with the sequences confirmed by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and submitted to GenBank, with the accession numbers and geographic origins listed in Table 3.

Viruses Nomination Accession No. Origin
KBV kbv-YN01 JX232598 Tengchong County
kbv-YN02 JX232599 Tengchong County
kbv-YN03 JX232600 Tengchong County
kbv-YN04 JX232601 Tengchong County
kbv-YN05 JX232602 Tengchong County
kbv-YN06 JX232603 Tengchong County
kbv-YN07 JX232604 Tengchong County
kbv-YN08 JX232605 Tengchong County
DWV dwv-YN01 JX679473 Kunming City
dwv-YN02 JX679474 Kunming City
dwv-YN03 JX679475 Kunming City
dwv-YN04 JX679476 Luoping County
dwv-YN05 JX679477 Luoping County
dwv-YN06 JX679478 Wuding County
dwv-YN07 JX679479 Dayao County
dwv-YN08 JX679480 Deqing County
SBV sbv-YN01 JX679481 Kunming City
sbv-YN02 JX679482 Kunming City
sbv-YN03 JX679483 DayaoCounty
sbv-YN04 JX679484 Mengzi City
sbv-YN05 JX679485 Jinghong City
sbv-YN06 JX679486 LuopingCounty
sbv-YN07 JX679487 LuopingCounty
sbv-YN08 JX679488 WudingCounty
BQCV bqcv-YN01 JN185928 LuopingCounty
bqcv-YN02 JN185929 LuopingCounty
bqcv-YN03 JN185930 LuopingCounty
bqcv-YN04 JN185931 Kunming City
bqcv-YN05 JN185926 Wuding County
KM1 JN185927 Kunming
bqcv-YN06 JN185932 DayaoCounty
bqcv-YN07 JN379018 DeqinCounty
bqcv-YN08 JX679489 Kunming City
bqcv-YN09 JX679490 Kunming City
bqcv-YN10 JX679491 Mengzi City
bqcv-YN11 JX679492 Tengchong County
bqcv-YN12 JX679493 Hekou County

Table 3: KBV, DWV, SBV and BQCV strains detected in Eastern bees from Yunnan Province.

Phylogenetic trees were constructed and bootstrap analysis was performed (Figure 2). Overview, all the virus isolates of BQCV, DWV, KBV and SBV from Yunnan province were grouped into independent cluster, respectively, except SBV YN07 fell into the reference sequence group. The BQCV samples in this study came from A. cerana in Yunnan province while the BQCV reference strains came from A. mellifera in Korea, USA, South Africa and Brazil. The nucleotide acid sequences of the isolated BQCV were 98.1%–100% identical between the 12 Yunnan isolates, and 94.3–99.6% to the 11 selected reference strains. Eight Chinese BQCV sequences in this study were aligned and compared to the sequences of the reference strains. The phylogenetic tree revealed that the eight BQCV isolated strains separated into three sub-groups: JH1 strain (JN379018) isolated in Xishuangbanna was more closely related to two references strains (EU375535, EU639830) that are known to be originally present in A.mellifera but were far from other isolates, while the Kunming isolated strains were located on an independent branch. Our results revealed that the virus has widely spread in A. cerana with prevalence rates can be as high as 80%. The nucleotide acid sequences of the amplified products of the DWV isolated strains were 95.4%–99.7% identical between the eight Yunnan isolates, and 92.7%–96.6% to the 10 reference sequences selected from GenBank. Further sequence analysis identified the eight isolated KBV strains shared 99.0%–100% nucleotide homology between the Yunnan isolates and 76.1%–95.4% nucleotide homologies with the 11 selected reported strains. The nucleotide acid sequences of the amplified fragments of the eight isolated SBV strains share 94.3%–100% nucleotide homology between the isolates and 94.0%–98.7% with the 12 selected references strains.

veterinary-science-technology-Phylogenetic-tree-constructed

Figure 2: Phylogenetic tree constructed by aligning the BQCV, DWV, KBV and SBV detected in Yunnan Province.

Determination of co-infection

The present study found multiple virus infections in 20.0% (54/270) of the bee samples. Among the samples with multiple infections, the dual-infection (SBV/DWV, BQCV/SBV, BQCV/DWV or BQCV/KBV) rate was 83.3% (45/54) and the triple-infection (BQCV/SBV/DWV) rate was 16.7% (9/54). Co-infection with SBV and BQCV occurred at the highest frequency (35.2%; 19/54). The most common regions for co-infection were Kunming City and Luoping County (Table 4).

Co-infection type Sampling site
Kunming Luoping Mengzi Wuding Dayao Tengchong Total
SBV/DWV 5 1 0 0 0 0 6
BQCV/SBV 6 4 2 4 3 0 19
BQCV/DWV 10 5 0 0 1 0 16
BQCV/KBV 0 0 0 0 0 4 4
BQCV/SBV/DWV 4 4 0 1 0 0 9
Total 25 14 2 5 4 4 54

Table 4: Frequency of dual and triple co-infections. The numbers shows the combinations of multiple virus infections, co-infection was found in 6 of 9 study regions.

Discussion

Before the introduction of superior varieties of Western bees into China, Eastern bees were the only breeding species. Eastern bees have unique biological and behavioral characteristics and play important roles as unique plant pollinators for commercially valuable crops, including oil crops, vegetables, and fruit trees, and as a wild nectar source [2]. Eastern bees are widely distributed in Yunnan province, from the low and hot valley of Hekou County (altitude 76.4 m, south of Yunnan) to the high and cold region of Zhongdian County (altitude 3600 m, northwest of Yunnan). Eastern bees can survive both in cold winter and in hot summer, providing various bee products (for example, honey and wax) with economic importance.

Bees in most parts of the world have undergone marked declines since the 1940s, one of the reason for this is that bees can be infected by at least 18 viruses and other pathogens [10]. Viral infection can occur during various growth and developmental stages of bees, but only a few of them result in serious disease. In earlier days, laboratory diagnosis of bee viruses was established based on electronic microscopic identification of the virus particles and antigens, and using techniques such as immunodiffusion test, radioimmunoassay, and enzyme-linked immunosorbent assay (ELISA) [11]. The sensitivity and specificity of most of these tests is low or they suffer from non-specific amplification and it is difficult to distinguish different virus types using these traditional methods. The lack of cell culture and in vitro techniques further hampered the development of molecular diagnostic methods. This study established RT-PCR methods for the rapid detection of six of the most common bee RNA viruses with high sensitivity and analytic specificity, and identified the prevalence status of DWV, SBV, KBV and BQCV in Eastern Bee colonies in Yunnan province. Among the nine regions in which BQCV, SBV, and DWV were screened, Luoping County showed very high infection rates. This is of particular concern as thousands hectares of canola are planted in this area each year and, while canola plants are in bloom, large numbers of hives arrive to this relatively small geographical location from many different regions of the country. In addition, it is well known that bee breeding enhances virus transmission.

A survey of the prevalence of seven bee viruses in Western and Eastern bees in 18 provinces in China found that infection rates varied dramatically between the two bee species. DWV, BQCV, SBV, Israel acute paralysis virus (IAPV), ABPV and CBPV were prevalent in Western bees, with DWV being the most prevalent at 94%. IAPV, DWV, CBPV, BQCV and SBV were found in Eastern bees, with SBV being the most dominant and present in 86% of apiaries [7].

SBV primarily affects bee broods, with color change in infected larvae from pearly white to pale yellow, and shortly after death they dry out, forming a dark brown gondola-shaped scale [12]. In China, SBV was first described in Guangdong province in 1972, and reemerged in Liaoning province in 2008, which caused lethal diseases in individual bees and the collapse of entire colonies [13]. A novel strain of SBV in Chinese bees that shares 86.8% nucleotide sequence homology and 93.4% amino-acid identity with reference strains has been detected in Guangdong Province [14]. SBV infection has also been reported prevalent in our neighboring countries like Thailand [15]. The present study revealed the presence of SBV (24.1%) of the screened samples in Yunnan province, of which the highest infection rate was in Kunming (56.7%). Considering that SBV mainly infects larvae, further studies focusing on the prevalence of this virus in larvae are needed to acquire specific prevalence data.

DWV infection is the most common in bees which has established persistent infection in most apiaries in the world since the first isolation of DWV in the early 1980s. DWV Infection is found in different bee castes including queens, drones, and workers, as well as in different bee developmental stages including eggs, larvae, pupae and adults. This virus is transmitted both vertically and horizontally [16]. While DWV usually persists as an asymptomatic infection, the virus can be re-activated when triggered by various host stress, causing symptoms of illness in infected bees [17]. The manifestations of the disease caused by DWV infection include shrunken and crumpled wings, decreased body size, discoloration in adult bees and a reduction in life span. The severe symptoms of DWV infections appear to be associated with Varroa destructor infestation of the bee hive, and studies have shown that Varroa destructor harbors even greater levels of the virus than found in severely infected bees [18]. A recent study [19] on 1 140 A. cerana worker samples was performed in 19 provinces in China between November 2010 and January 2011. However, no data about DWV from Yunnan province was available in this study and only very limited spots were sampled. Our study revealed that 14.8% of screen samples were positive for DWV, the highest of which was present in Kunming (76.7%), and this virus was also prevalent in Luoping County, Wuding County, Dayao County and Deqin County.

KBV was first confirmed in A. cerana Fabricius and analysis of the genome sequence shows that KBV is a cricket paralysis-like virus (Dicistroviridae cripavirus) [20,21]. Like most bee viruses, KBV is thought to persist as an asymptomatic infection within the bee community, until stress or an alternative vector (such as Varroa) activates it to become epidemic and lethal [22]. There is a report indicating that when KBV carrier bees are pierced and suckled by Varroa destructor, KBV is activated which results in viremia, thus causing a large number of bee deaths. However, as of yet, no one has found a way to culture bee viruses in vitro, which has hampered the study of viral diseases in bees. As a result, the relationship between crawling disease and Varroa destructor infection and the prevalence of KBV in China has yet to be fully elucidated. We found the positive rate of KBV in Yunnan province is 26.7%, which is the first report of KBV infection in Eastern bees in China.

BQCV infection was more prevalent in adult bees than in pupae, but the infected worker bees normally do not exhibit significant disease symptoms and that the incidence of BQCV was higher in spring and summer than in autumn [23]. BQCV is the most common cause of death of queen larvae in Australia and Poland [21]. More and more BQCV strains have been isolated and identified from A. mellifera making it the second most prevalent virus infection in this species after DWV [24]. The variability of BQCV isolates collected from a variety of geographic regions can be further understood by molecular comparison and determination of genomic relationships between the strains.

DWV is present in all developmental stages and castes, with significant economic importance due to its close association with bee colony collapse induced by Varroa destructor. DWV is considered as a common global bee virus which is present in both laboratory-reared and wild populations of bumble bees (Bombus huntii) [1,25] DWV and BQCV are common multi-host and prevalent viruses in European bees. Queen, worker or drone broods can be infected by these two viruses without apparent morphologic alterations, although symptomatic BQCV infection of such broods has also been reported [26].

Multiple infections with different viruses are very common in both Western and Eastern bees [27]. This phenomenon has also been reported in many countries including France, Hungary, USA, Austria, Southwest England and South Korea [7]. The dynamics of these coexisting virus populations within these colonies is of great interest and it would be useful to determine how they fluctuate with respect to each other [28]. Therefore, the incidence of dual and triple infections confirmed in this study is unsurprising.

ABPV and CBPV were not detected in this study, which is coincident with a previous investigation in Japan [29], where the study of Apis mellifera and Apis cerana japonica colonies with RT-PCR has revealed CBPV infection in A. mellifera but not in A. c. japonica colonies in Japan. The possible reasons why we did not detect ABPV or CBPV from Yunnan could be as follows: 1). The Apis cerana populations in the areas under investigation in Yunnan province are free of infection of ABPV and CBPV; 2). The virus titer was so low, which is beyond the detection sensitivity of classical RT-PCR: 3). After propagation and adaption in the Apis cerana, ABPV and CBPV accumulated sequence variation within the primer regions where we started the amplifications.

Although Eastern honey bee population in China is often infected with Varroa, the samples we collected were free of Varroa infestation. However, Varroa infestation was observed in the beehives where we collected the samples, which could be one of the reasons of virus transmission. Since these viruses are often latent in honey bees and our study was based mainly on qualitative detection of the viruses, it is unclear, to what extent the results are relevant for pathology, which is worth of further investigation. Furthermore, due to the unavailability of cell culture models for honey bee viruses, quantitative analysis of the titers of the viruses is technically and practically difficult. Recently, new viruses were discovered in Apis mellifera like Lake Sinai Virus [30], it can also be worthy to investigate these viruses in A. cerana in the future study.

In conclusion, our study investigated the prevalence of the six most common bee RNA viruses that are known to cause diseases in bee colonies in Yunnan Province of China. We demonstrated that BQCV, DWV, KBV and SBV are already widely prevalent in Yunnan province and that Luoping County and Kunming city had the highest infection rates. For the first time we showed that KBV could infect A. cerana and is already prevalent in Tengchong County. Phylogenetic analysis revealed that most of the Yunnan isolates are likely clustered into independent branches. We demonstrated a geographic separation of Yunnan isolates from most of the reference isolates. The lack of major exchange of honey bees between Europe/mainland US and Yunnan for the recent decades may have resulted in the geographic separation of Yunnan isolates. Therefore, the results in our study strongly suggest that sequence analysis can play an important role in tracing the origins of honey bee virus strains and diagnosis of honey bee disease in Chinese populations during epizootics.

Acknowledgments

This work was supported by a grant from the Modern Agro-industry Technology Research System of China (No. CARS-45-kxj14) and the Key Laboratory of Veterinary Public Health of Higher Education of Yunnan Province.

Conflict of Interest

The authors declare that they have no conflict of interest.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Article Usage

  • Total views: 8538
  • [From(publication date):
    January-2016 - Nov 20, 2018]
  • Breakdown by view type
  • HTML page views : 8436
  • PDF downloads : 102

Review summary

  1. rampalverma
    Posted on Sep 24 2016 at 2:15 pm
    Article talks about the investigate the prevalence of these six viruses in Eastern bees from nine major bee breeding regions. This play an important role in tracing the origins of honey bee virus strains and diagnosis of honey bee disease in Chinese populations during epizootics. The experiment was well designed and analyses were performed proper to answer the authors' purpose.
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri and Aquaculture Journals

Dr. Krish

[email protected]

+1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version