alexa Prevalence of qnr Genes and Antibiotic Susceptibility Patterns among Clinical Isolates of Klebsiella Pneumoniae in West of Iran | Open Access Journals
ISSN: 2155-9597
Journal of Bacteriology & Parasitology
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Prevalence of qnr Genes and Antibiotic Susceptibility Patterns among Clinical Isolates of Klebsiella Pneumoniae in West of Iran

Mozhgan Azadpour1, Younes Soleimani2, Faranak Rezaie1, Elnaz Nikanpour3, Hossein Mahmoudvand4* and Sareh jahanbakhsh4

1Razi Herbal Medicine Research Center, Lorestan University of Medical Science, Khorram abad, Iran

2Department of Microbiology, Qom Branch, Islamic Azad University, Qom, Iran

3Department of Biology, Science and Research Branch, Islamic Azad University, Tehran, Iran

4Research Center for Tropical and Infectious Diseases, Kerman University of Medical Sciences, Kerman, Iran

*Corresponding Author:
Hossein Mahmoudvand
Research Center for Tropical and Infectious Diseases
Kerman University of Medical Sciences, Kerman, Iran
Tel: +98-341-2112794
Fax: +98-341-2112794
E-mail: [email protected]

Received date: April 21, 2014; Accepted date: September 22, 2014; Published date: September 26, 2014

Citation: Azadpour M, Soleimani Y, Rezaie F, Nikanpour E, Mahmoudvand H, et al. (2014) Prevalence of qnr Genes and Antibiotic Susceptibility Patterns among Clinical Isolates of Klebsiella Pneumoniae in West of Iran. J Bacteriol Parasitol 5:202. doi: 10.4172/2155-9597.1000202

Copyright: © 2014 Azadpour M et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Bacteriology & Parasitology

Abstract

Background: This study aimed to define prevalence of qnr genes and antibiotic susceptibility patterns among clinical isolates of K. pneumoniae in Lorestan province, west of Iran.

Methods: Totally, 107 K. pneumoniae isolates were randomly collected since December until September 2012 from hospitalized patients at general hospitals in Lorestan, Iran. The isolates were from different clinical samples including urine, sputum, etc. Biochemical characterizations were performed for detecting isolates. Antibiotic susceptibility testing by disk diffusion method was performed according to recommendations of Clinical and Laboratory Standards Institute using 12 antibiotic disks. K. pneumonia isolates were screened by multiplex PCR amplification of qnrA, qnrB and qnrS using specific primers and sequence analysis of amplified regions of the isolates was also performed.

Results: 43 (40.2%) out of 107 isolates were multidrug-resistant (MDR). Ciprofloxacin (Quinolone) susceptibility testing showed that 34 isolates were resistant, 7 isolates were intermediately resistant and 66 isolates were sensitive. 18 (16.8%) out of 107 K. pneumoniae clinical isolates were positive for qnr gene. Among all the qnr-positive isolates, 16 isolates (88.9%) carried qnrB, 1 isolate (5.55%) carried qnrS and the rest (5.55%) carried both qnrB and qnrS genes while no qnrA was detected in these clinical isolates. qnr determinants were detected in 8 (23.5%) of the ciprofloxacin-resistant isolates as well as 1 (14.3%) and 9 (13.6%) intermediate and sensitive isolates, respectively. No significant association was observed between ciprofloxacin resistance and presence of qnr genes (P>0.05).

Conclusion: Findings of the present study indicated that emergence of qnr determinants contributed to development and spread of quinolone resistance in Iranian isolates of K. pneumonia.

Keywords

Klebsiella pneumonia, qnr gene, Quinolone resistance, Lorestan, Iran

Introduction

Klebsiella pneumonia (family Enterobacteriaceae) is an opportunistic pathogen that usually causes hospital and community acquired bacterial infections in humans [1]. In recent years, emergence of multidrug-resistant K. pneumoniae isolates has become a serious antibiotic management problem and led to great concern around the world [1,2]. At present, quinolone resistance is a widespread phenomenon among the Enterobacteriaceae [2,3]. Main mechanisms of resistance to quinolones in this family including mutations in the quinolone resistance determining regions (QRDRs) of DNA gyrase and topoisomerase IV, efflux pumps enhancement or decreased accumulation mediated by reduce in permeability of bacterial cell wall are chromosomally mediated [4-8]. Recently, mechanisms of plasmid- mediated quinolones resistance (PMQR) by qnr genes have been reported [9] These qnr genes (qnrA, qnrB and qnrS) encode proteins of the pentapeptide repeat family that interfere with the action of quinolones on bacterial DNA gyrase and topoisomerase IV [9-11]. Although the qnr gene indicates a low level of resistance to quinolones, its attendance aids the selection of chromosomal mutations, facilitating increased resistance in the host strain [9-11]. Frequency of qnr genes PMQR associated with the qnr genes in different human clinical enterobacterial isolates was determined first in the USA in 1994 using a K. pneumoniae isolate (later termed qnrA1) [9], which was then widely reported worldwide [12-19]. However, no study has been done on prevalence of qnr genes among enterobacterial clinical isolates in Iran. For the first time, this study aimed to define prevalence of qnr genes and antibiotic susceptibility patterns among clinical isolates of K. pneumoniae from general hospitals in Lorestan province, west of Iran.

Materials and Methods

Studied area

This descriptive study was carried out since December until September 2012 on hospitalized patients at general hospitals of Lorestan province, located between valleys of Zagros Mountain in west of Iran and bordering with provinces of Markazi, Hamedan, Kermanshah, Khuzestan, Ilam and Isfahan. Lorestan covers an area of 28.294 km2 and its population is approximately 2 million people. Major cities of this province are Khorramabad, Borujerd, Aligoodarz, Dorood, Koohdasht, Azna, Alashtar, Noorabad and Pol-e-Dokhtar (Figure 1) [20].

bacteriology-parasitology-Geographical-locations

Figure 1: Geographical locations where this study was carried out

Bacterial isolates

Totally, 107 K. pneumoniae isolates were randomly collected since December until September 2012 from hospitalized patients at general hospitals of Lorestan, Iran. The isolates were collected from different specimens, including urine, sputum, lesion, blood and other specimens. All the isolates were routinely cultured on Mueller-Hinton (MH) agar plates and typical colonies were picked up and identified by biochemical tests using the API®-20E test kits (bioMérieux, Lyon, France). The bacteria were grown at 37°C for 18–24 h in order to prepare bacterial suspension and DNA extraction.

Susceptibility testing

Antibiotic susceptibility of the isolates to amikacin (10 μg), ampicillin (10 μg), meropenem (10 μg), nalidixic acid (30 μg), cefotaxime (30 μg), ceftazidime(30 μg), cefteriaxone (30 μg), cephalexine, ciprofloxacin (5 μg), cefexim (30 μg), gentamicin (10 μg) and imipenem(10 μg) (all the antibiotics were purchased from Oxoid, UK) was determined by disk diffusion method as recommended by Clinical and Laboratory Standards Institute (CLSI) [21] on Mueller–Hinton agar plates. In addition, K. pneumoniae ATTC BAA-1705 was used as a quality control strain.

Screening for qnr genes

The 107 clinical isolates of K. pneumoniae were screened by multiplex PCR amplification of qnrA, qnrB and qnrS using specific primers shown in Table 1, as previously described by Robicsek et al. [3]. Briefly, the colonies were transferred to an Eppendorf tube filled with water and boiled to prepare DNA templates for PCR. Target fragments were amplified under PCR conditions of 94°C for 45 s, 53°C for 45 s and 72°C for 60 s with cycle number of 32. Positive (containing strains with known qnr genes) and negative (without DNA template) controls were included in each run. Amplification products were provisionally identified according to their sizes in ethidium bromide-stained agarose gels.

Amplicon Primers Sequence (5'–3') Size (bp)
QnrA qnrA-A qnrA-B ATTTCTCACGCCAGGATTTG GATCGGCAAAGGTTAGGTCA 516
QnrB qnrB-A qnrB-B GATCGTGAAAGCCAGAAAGG ACGATGCCTGGTAGTTGTCC 469
QnrS qnrS-A qnrS-B ACGACATTCGTCAACTGCAA TAAATTGGCACCCTGTAGGC 417

Table 1: Sequences of primers used for multiplex PCR

DNA sequencing

DNA sequence analysis was performed using direct sequencing of both strands using an auto-sequencer. The obtained DNA sequences were compared and analyzed using BLAST online search engine from GenBank in website of National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/blast).

Statistical analysis

Data analysis was carried out using SPSS statistical package (version 17.0) (SPSS Inc., Chicago, IL, USA). P value of <0.05 was considered statistically significant.

Results

Out of 107 isolates, 43 isolates (40.2%) were multidrug-resistant (MDR). The highest rate of resistance was observed in ceftazidime and cefotaxime. Moreover, the lowest rate of resistance was seen in imipenem, meropenem and amikacin, respectively. Ciprofloxacin (Quinolone) susceptibility testing showed that 34 isolates (31.8%) were resistant, 7 isolates (6.5%) were intermediately resistant and 66 isolates (61.7%) were sensitive. 18 (16.8%) out of 107 K. pneumoniae clinical isolates screened by multiplex PCR, were positive for the qnr gene. Among all the qnr-positive isolates, 16 isolates (88.9%) carried qnrB, 1 isolate (5.55%) carried qnrS and the rest (5.55%) carried both qnrB and qnrS genes while no qnrA was detected in the present clinical isolates. Table 2 shows clinical characteristics of these isolates and distribution of qnrA, qnrB and qnrS. Qnr determinants were detected in 8 (23.5%) of the ciprofloxacin-resistant isolates as well as 1 (14.3%) and 9 (13.6%) intermediate and sensitive isolates, respectively (Table 3). No significant association was found between ciprofloxacin resistance and presence of qnr genes (P=0.074). Moreover, complete sequences of positive qnrB and qnrS isolates were submitted to the GenBank database and assigned accession numbers AB894351, AB894352, AB894353 and AB894354.

Number of Strains Specimen Sex Age Diagnoses Qnr
Kp6 Sputum Male 12 Months Pneumonia qnrB
Kp 8 Urine Male 6 years UTIa a qnrB
Kp13 Sputum Female 23 years Pneumonia qnrB
Kp17 Urine Female 9 years UTIa qnrS
Kp18 Sputum Male 3 years Pneumonia qnrB
Kp19 Tracheal Male 51 years Pneumonia qnrB
Kp26 Sputum Male 13 years Pneumonia qnrB
Kp33 Sputum Female 6 Months Pneumonia qnrB
Kp42 Urine Female 33 years UTIa qnrB
Kp44 Sputum Male 14 Months Pneumonia qnrB
Kp57 Urine Female 52 years UTIa qnrB
Kp68 Sputum Female 12 Months Pneumonia qnrB
Kp73 Urine Male 4 years UTIa qnrB
Kp84 Sputum Female 8 Months Pneumonia qnrB, qnrS
Kp93 Sputum Male 2 years Pneumonia qnrB
Kp97 Urine Male 19 Months UTIa qnrB
Kp101 Sputum Female 11years Pneumonia qnrB
Kp104 Sputum Male 47 years Pneumonia qnrB

Table 2: Clinical characteristics and qnr genotype of the qnr -positive isolates. a :Urinary tract infection

Ciprofloxacin susceptibility No. (%) isolate with qnr determinants
  qnrA qnrB qnrS qnrB + qnrS Total
Sensitive (n=66) 0 (0) 8 (12.1) 0 (0) 1 (1.5) 9 (13.6)
Intermediate (n=7) 0 (0) 1 (16.6) 0 (0) 0 (0) 1 (14.3)
Resistant (n=34) 0 (0)   7 (20.6) 1 (2.9) 0 (0) 8 (23.5)
Total (n=107) 0 (0) 16 (14.9) 1 (0.93) 1 (0.93) 18(16.8)

Table 3: Frequency of qnr genes based on ciprofloxacin (Quinolone) susceptibility in K. pneumoniae isolates from Lorestan, Iran

Discussion

Klebsiella pneumoniae colonizes >75% of hospitalized patients and causes the estimated 8% of all nosocomial infections including pneumonia, urinary tract, wound and diarrhoea infections [22]. At present, emergence of multidrug-resistant K. pneumoniae isolates have become a serious antibiotic management problem and led to great concern worldwide [1,2]. This investigation provided the first epidemiological survey on the frequency of qnrA, qnrB and qnrS genes by multiplex PCR in Lorestan province, Iran, between December and September 2012. In this survey, qnr genes were determined in 18 (16.8%) of the isolates. This rate of qnr prevalence was consistent with some studies carried out in Taiwan and the USA (15, 16). Prevalence of qnr in the present study was also higher than that shown in other areas in Brazil (2.3%), Singapore (5.2%) and the USA (11.1%) [12,13,17]. In contrast, it was much lower than the prevalence of qnr genes detected in Malaysia (48.9%) and China (65.5%) [14,19].

The present findings indicated that qnrB was the most prevalent one (88.9%), followed by qnrS (5.55%), whereas no isolates carried qnrA among all the clinical isolates. In the studies conducted by Minarini et al. [13] and Saiful et al. [19] on clinical isolates in Brazil (2.3%) and Malaysia (31.9%), respectively, qnrB has been proven to be more prevalent than other qnr genes among the tested clinical isolates. In contrast, in other investigations carried out in China and the USA, it has been shown that qnrS (14.9%) and qnrA (14%) are the most prevalent of all K. pneumoniae clinical isolates screened by multiplex PCR, respectively [16,18]. The present investigation shows no qnrA in its clinical isolates; similarly, Minarini et al. [13] and Saiful et al. [19] in Brazil and Malaysia have indicated no qnrA or qnrS-positive isolates among their clinical isolates of K. pneumonia, respectively.

In the present study, qnr determinants (qnrA, qnrB and qnrS) were identified from 8 (23.5%) ciprofloxacin-resistant, 1 (14.3%) intermediate and 9 (13.6%) sensitive isolates. Similar to these results, Saiful et al. [19] reported that the highest percentage of qnr determinants (47.8%) was found in ciprofloxacin-resistant isolates. It has been previously demonstrated that clinical isolates with qnr determinants are known to harbor multiple ciprofloxacin resistance mechanisms such as variations in gyrA or reduce the drug permeability and therefore facilitate high resistance to ciprofloxacin [9,10]. In this survey, it was also proven due to lack of significant association between ciprofloxacin resistance and presence of qnr determinants. Moreover, the results reflected considerable frequency of qnr-positive K. pneumonia among clinical isolates in Iran. This frequency of qnr genes indicated that qnr genes were disseminating and subsequently prevalence of MDR K. pneumonia was increasing because of probable increasing resistance to quinolone.

Conclusion

The findings of our study showed considerable frequency of qnr-positive K. pneumonia among clinical isolates in Iran. Therefore, it is necessary to properly use antibiotics, especially quinolone antibiotics, and continuously monitor resistance patterns in K. pneumoniae in hospital settings.

Acknowledgements

This study was supported by Research Center for Tropical and Infectious Diseases, Kerman University of Medical Sciences, Kerman, Iran. We would like to thank Dr. Farnaz Kheirandish and Dr. Hossein Hosseini Naveh for data analysis and data collection.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 11785
  • [From(publication date):
    December-2014 - Aug 22, 2017]
  • Breakdown by view type
  • HTML page views : 7988
  • PDF downloads :3797
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords