alexa
Reach Us +441414719275
Rabbit Meat as a Possible Source for Multidrug Resistant Listeria monocytogenes
ISSN: 2157-7579

Journal of Veterinary Science & Technology
Open Access

Like us on:

OMICS International organises 3000+ Global Conferenceseries Events every year across USA, Europe & Asia with support from 1000 more scientific Societies and Publishes 700+ Open Access Journals which contains over 50000 eminent personalities, reputed scientists as editorial board members.

Open Access Journals gaining more Readers and Citations
700 Journals and 15,000,000 Readers Each Journal is getting 25,000+ Readers

This Readership is 10 times more when compared to other Subscription Journals (Source: Google Analytics)
All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.
  • Research Article   
  • J Vet Sci Technol 10: 579, Vol 10(3)

Rabbit Meat as a Possible Source for Multidrug Resistant Listeria monocytogenes

Alaa Eldin MAM1, Darwish WS1*, El-Sayed SEIS2 and Ali ELSM2
1Food Control Department, Faculty of Veterinary Medicine, Zagazig University, 44519 Zagazig, Egypt
2Eductational Veterinary Hospital, Faculty of Veterinary Medicine, Zagazig University, 44519 Zagazig, Egypt
*Corresponding Author: Darwish WS, Food Control Department, Faculty of Veterinary Medicine, Zagazig University, 44519 Zagazig, Egypt, Tel: +251916053245, Email: [email protected]

Received Date: Mar 08, 2019 / Accepted Date: Apr 15, 2019 / Published Date: May 25, 2019

Abstract

Rabbit meat is a rich source of protein with low fat and cholesterol contents making it a healthy meat source. Listeria monocytogenes is one of foodborne pathogens that can cause a serious disease named listeriosis in humans. This study firstly investigated the prevalence of Listeria spp., particularly Listeria monocytogenes in rabbit meat and offal. Secondly, the expression of virulence associated genes and the antibiogram of the identified Listeria monocytogenes were further examined. The achieved results revealed that Listeria spp. was isolated from rabbit thigh muscles, shoulder muscles, loin, liver and kidneys at 25%, 15%, 10%, 15% and 5%, respectively. Five Listeria spp. namely, L. monocytogenes, L. ivanovii, L. innocua, L. welshimeri and L. seeligeri were serologically identified. Multidrug pathogenic L. monocytogenes was particularly isolated from thigh muscles and loin only at 12.5% and 7.5%, respectively. L. monocytogenes isolates showed a complete resistance (100%) to both of kanamycin and neomycin.

Keywords: Listeria monocytogenes; Rabbit meat; Antibiogram; Virulence genes

Introduction

Rabbit meat industry is developing in many Middle-Eastern countries including Egypt as rabbits are characterized by the short production cycle, high feed conversion ratio, high fertility rates, and require small space area [1]. Rabbit meat is also of high protein and low fat and cholesterol levels making it very healthy meat source [2]. However, rabbit meat like any kind of meat might be contaminated with potential pathogenic microorganisms during slaughtering, processing, evisceration or transportation [3]. Therefore, rabbit meat may be considered as a possible source for transmission of bacterial foodborne pathogens such as Salmonella spp., Escherichia coli and Staphylococcus aureus [4]. However, few reports studied the microbial status of rabbit meat, particularly in Egypt.

Listeria spp. is considered of major public health significance, in particular the most important pathogenic species, L. monocytogenes [5]. Listeria monocytogenes is a widespread foodborne pathogen, which is able to grow and survive over a wide range of temperatures, pH and water activities making it among the most serious threats to human health [6,7]. Almost 99% of human listeriosis has resulted from consumption of contaminated foods [8]. The symptoms of human listeriosis include fatigue, chills, headache, and gastroenteritis. If not properly treated, the disease can develop into septicemia, abortion, meningitis, encephalitis and finally death [9]. Therefore, continuous monitoring for the prevalence rates of L. monocytogenes in retailed meat and offal in Egypt is a matter of importance for both consumer’s safety and food hygiene.

The extensive use of antibiotics in animal farms including rabbit intensive rearing systems is continuous in Egypt for the prevention and control of bacterial diseases and as animal feed additives, however, the uncontrolled irregular use of such antibiotics may result in development of drug-resistant pathogens, which make the treatment of such bacterial diseases in diseased humans and animals of high difficulty [10].

In sight of the previous facts, this study aimed at investigation of the prevalence of multidrug-resistant Listeria spp. in the retailed rabbit meat and offal in Egypt. The antibiogram and the expression of virulence-associated genes in the isolated and identified L. monocytogenes were also carried out.

Materials and Methods

Collection of samples

A total of 40 random rabbit carcasses were collected from rabbit butchery shops at different sanitation levels in Zagazig city, Sharkia Governorate, Egypt. From each rabbit carcass, thigh muscles, shoulder muscles, loin, liver and kidney (n=40 each) were collected. The collected samples were defined and packed in sterile plastic bags then labeled and immediately transferred under sanitary precautions in an icebox without undue delay to the Laboratory of Meat Hygiene and Technology, Faculty of Veterinary Medicine, Zagazig University, Egypt. The collected samples were examined bacteriologically for the presence of Listeria monocytogenes.

Bacteriological examination

Isolation and identification of Listeria spp: Detection and enumeration of Listeria monocytogenes in the examined samples were done according to the methods described before [11].

Enrichment procedures: Under complete aseptic conditions, 10 grams from each sample were aseptically transferred into a sterile blender containing 90 ml of sterile peptone water 1%. The contents were homogenized at 3000 rpm for 3 min at 25°C, then allowed to stand for 5 min. The homogenate was incubated at 37°C for 24 h for pre-enrichment of the samples. After incubation, 1 ml of the culture was transferred into a tube containing 9 ml of secondary enrichment medium (Full Fraser broth), then incubated at 37°C for 48 h.

Isolation procedures: A loopeful from the Full Fraser broth culture was streaked onto Oxford media (Himedia, Mumbai, India) with Listeria Oxford supplement (Himedia, Mumbai, India) and incubated for 24-48 h at 35°C and then observed for the presence of typical Listeria colonies. Colonies presumptive for Listeria spp. (showing morphological characters as dew drop-like, black with brown hallow, or dark brown colonies 1-2 mm in diameter) were inoculated into Tryptone Soya broth supplemented with 0.6% yeast extract and kept at 4°C for further identification.

Identification of Listeria isolates: Pure presumptive isolates were identified morphologically and biochemically [12,13] and serologically using the Oxoid Listeria Test Kit (Oxoid, Basingstoke, Hampshire, England) according to the manufacturer’s instructions.

Molecular identification of Listeria monocytogenes virulent genes

Application of multiplex-PCR for molecular characterization of virulence factors of the isolated L. monocytogenes strains represented by invasive associated protein (iap), haemolysin (hylA) and actin polymerization protein (actA) genes was essentially performed using Primers (Pharmacia Biotech) as shown in Table 1.

Target gene Oligonucleotide sequence (5′ → 3′) Product size (bp)
iap (F) 5′ ACAAGCTGCACCTGTTGCAG ′3 131
iap (R) 5′ TGACAGCGTGTGTAGTAGCA ′3
hlyA (F) 5′ GCAGTTGCAAGCGCTTGGAGTGAA ′3 456
hlyA (R) 5′ GCAACGTATCCTCCAGAGTGATCG ′3
actA (F) 5′ CGCCGCGGAAATTAAAAAAAGA ′3 839
actA (R) 5′ ACGAAGGAACCGGGCTGCTAG ′3

Table 1: Oligonucleotide primer sequences used in the present study.

DNA extraction using QIA amp kit

The technique recommended by Shah et al. [14] was applied with some modifications. All detected L. monocytogenes strains were grown overnight on brain heart infusion broth at 37°C, and the suspension was then heated at 100°C for 20 min. Accurately, 50-200 μl of the culture were placed in Eppendorf tube and kept frozen at -40°C till use. The obtained lysate (5 μl) was used as DNA template in PCR reaction mixture.

Amplification reaction of L. monocytogenes

The amplification was performed on a Thermal Cycler (Master cycler, Eppendorf, Hamburg, Germany). A multiplex PCR was performed with comprising three virulence-associated genes (iap, hlyA and actA). The multiplex PCR was set up in 50 μl reaction volume. The cycling conditions for PCR included an initial denaturation of DNA at 95°C for 2 min followed by 35 cycles each of 15 sec denaturation at 95°C, 30 sec annealing at 60°C and 1 min extension at 72°C, followed by a final extension of 10 min at 72°C and held at 4°C. Amplified DNA fragments were analyzed by 1.5% of agarose gel electrophoresis (Applichem, Germany, GmbH) in 1x TBE buffer stained with ethidium bromide and captured as well as visualized on UV transilluminator. A 100 bp plus DNA Ladder (Qiagen, Germany, GmbH) was used to determine the fragment sizes.

Antibiogram of the isolated Listeria monocytogenes

Antimicrobial susceptibility was tested by the single diffusion method. Sensitivity discs with variable concentrations were used to determine the susceptibility of the isolated bacterial strains (Oxoid Limited, Basingstoke, Hampshire, UK) (Table 2). Agar plate method was applied by using of nutrient agar as a substrate for growth of the tested bacterium for its antibiotic sensitivity. The antimicrobial susceptibility testing was applied according to the guidelines stipulated by National Committee for Clinical Laboratory Standards (NCCLS) [15]. The tested strains were evaluated as susceptible, intermediate and resistant. Multiple Antibiotic Resistance (MAR) index for each strain was determined according to the formula stipulated by Singh et al. [16] as follow:

Antimicrobial agent Sensitivity disc content (µg) Resistant (mm) Intermediate (mm) Susceptible (mm)
Neomycin (N) 30 12 or less 13-16 17 or more
Ampicillin (AM) 10 13 or less 14-17 18 or more
Chloramphenicol (C) 30 12 or less 13-17 18 or more
Ciprofloxacin (CP) 5 15 or less 15-19 20 or more
Erythromycin (E) 15 13 or less 14-22 23 or more
Cephalothin (CN) 30 14 or less 15-17 18 or more
Gentamicin (G) 10 12 or less 13-14 15 or more
Enrofloxacin (EN) 5 11 or less 12 13 or more
Kanamycin (K) 30 13 or less 14-17 18 or more
Oxacillin (OX) 1 10 or less 11-Dec 13 or more
Streptomycin (S) 10 11 or less Dec-14 15 or more
Oxytetracycline (T) 30 14 or less 15-18 19 or more
Nalidixic acid (NA) 30 13 or less 14-18 19 or more
Sulphamethoxazol (SXT) 25 10 or less Nov-15 16 or more

Table 2: Antimicrobial discs, concentration and interpretation of the reactions on the isolated pathogens.

MAR index=Number of resistance (Isolates classified as intermediate were considered sensitive for MAR index)/Total Number of tested antibiotics.

Results and Discussion

The achieved results in the present study revealed that Listeria spp. was isolated from rabbit thigh muscles, shoulder muscles, loin, liver and kidneys at 25%, 15%, 10%, 15% and 5%, respectively (Table 3). The overall isolation percentage of Listeria spp. from rabbit meat in Egypt in the present study was 14%. This level is corresponding to the isolation rate (11%) of Listeria spp. from rabbit meat products and carcasses retailed in Italy [17]. Serological identification of the isolated Listeria spp. revealed the incidence of five Listeria spp. namely, L. monocytogenes, L. ivanovii, L. innocua, L. welshimeri and L. seeligeri. The total incidence of these species in the examined rabbit samples was 28.57%, 21.43%, 35.72%, 7.14% and 7.14% respectively (Table 4). L. monocytogenes was particularly isolated from thigh muscles and loin only at 12.5% and 7.5%, respectively. In agreement with the recorded results, L. monocytogenes was previously isolated from minced rabbit meat in Egypt [1] and rabbit carcasses in Italy [17]. Listeria spp. is an opportunistic intracellular pathogen that is able to survive under extreme pH, osmolarity and temperature, it has been detected in a variety of meat products and rabbit meat processing plants [18,19]. Contamination of rabbit meat with foodborne pathogens gives an indication about the unsatisfactory hygienic measures adopted during processing of such an important meat source [3].

Samples Number Positive Listeria spp.
Number %
Thigh muscles 40 10 25%
Shoulder muscles 40 6 15%
Loin 40 4 10%
Liver 40 6 15%
Kidneys 40 2 5%
total 200 28 14%

Table 3: Prevalence rates of Listeria spp. isolated from the examined rabbit samples.

Samples Listeria monocytogenes Listeria ivanovii Listeria innocua Listeria welshimeri Listeria seeligeri
Thigh muscles 5 (12.5%) 0% 3 (7.5%) 1 (2.5%) 1 (2.5%)
Shoulder muscles 0% 2 (5%) 0% 1 (2.5%) 0%
Loin 3 (7.5%) 0% 2 (5%) 0% 1 (2.5%)
Liver 0% 4 (10%) 2 (5%) 0% 0%
Kidneys 0% 0% 2 (5%) 0% 0%
Total 8 (28.57%) 6(21.43%) 10(35.72%) 2 (7.14) 2 (7.14%)

Table 4: Incidence of the serologically identified Listeria spp. isolated in the examined rabbit samples.

Listeriosis is a disease caused by L. monocytogenes infections in human, particularly in the elderly, infants and immunocompromised patients and lead to several symptoms including meningitis, encephalitis, abortion and even death [20]. The occurrence of such symptoms is mainly related to the expression of virulence-associated genes in Listeria isolates. The expression profile of three virulence determinants, iap, hylA and actA, in the current investigation is shown in Figure 1. It was obvious that a clear polymorphism occurred among the obtained Listeria isolates. All obtained Listeria isolates harbored iap (100%), while 7 isolates (87.5%) expressed hylA and only 5 (62.5%) isolates expressed actA. The presence of such virulent genes in the Listeria isolates is necessary for the pathogenicity and indicate the possibility of disease occurrence among consumers if such contaminated meat is ingested without proper handling. Polymorphism among Listeria isolates is reported in several studies in USA and Brazil [18,21].

veterinary-science-technology-gene-expressions

Figure 1: Virulence-associated gene expressions among identified L. monocytogenes isolates An agarose gel electrophoresis of multiplex PCR of iap (131 bp), hylA (456 bp) and actA (839 bp) virulence genes for characterization of L. monocytogenes . Lane M: 100 bp ladder as molecular size DNA marker. Lane C+: Control positive L. monocytogenes for iap, hylA and actA genes. Lane C-: Control negative. Lanes 1, 3, 4 and 8: Positive L. monocytogenes for iap, hylA and actA genes. Lanes 2, 6 and 7: Positive L. monocytogenes strains for iap and hylA genes. Lane 5: Positive L. monocytogenes strain for iap and actA genes.

The extensive and abuse of antibiotics in animal farms led to development of multidrug resistant bacterial strains. In the present study, L. monocytogenes isolates showed a complete resistance (100%) to both of kanamycin and neomycin. The percentage of the resistance among the tested antimicrobials were as following nalidixic acid (87.5%), penicillin G (75%), cephalothin (75%), erythromycin (62.5%), sulphamethoxazol (50%) and cefotaxime (50%). However, the obtained isolates of L. monocytogenes showed marked sensitivity to ampicillin (62.5%), doxycycline (62.5%), gentamicin (75%) and amikacin (87.5%) (Table 5). The average MAR index for the identified L. monocytogenes isolates was 0.535 (Table 6). These results go in agreement with Yucel et al. [22] who reported that all L. monocytogenes isolates from raw or cooked meat product in Turkey were resistant to cephalothin and nalidixic acid and 66% of isolates were resistant to sulfamethoxazole, ampicillin, and trimethoprim. Similarly, in China, 73% of 167 L. monocytogenes isolated from retail food products were resistant to sulfonamide, 8.4% were resistant to tetracycline and 1.8% were resistant to ciprofloxacin [23]. In conclusion, the current study revealed the isolation of multidrug pathogenic L. monocytogenes from rabbit meat and offal retailed in Egypt. Therefore, strict hygienic measures should be followed during preparation and processing of rabbit meat before serving to humans.

Antimicrobial agent S I R
n % n % n %
Kanamycin (K) - - - - 8 100
Neomycin (N) - - - - 8 100
Nalidixic acid (NA) - - 1 12.5 7 87.5
Penicillin G (P) - - 2 25 6 75
Cephalothin (CN) 1 12.5 1 12.5 6 75
Erythromycin (E) - - 3 37.5 5 62.5
Sulphamethoxazol (SXT) 2 25 2 25 4 50
Cefotaxim (CF) 3 37.5 1 12.5 4 50

Table 5: Percentages of antimicrobial susceptibility of L. monocytogenes (n=8). Where n refers to number of isolates; S is sensitive; I is intermediate; R is resistant.

No. Listeria strains Antimicrobial resistance profile  
1 L. monocytogenes K, N, NA, P, CN, E, SXT, CF, T, CP, AM, DO, G, AK 1
2 L. monocytogenes K, N, NA, P, CN, E, SXT, CF, T, CP, AM, DO 0.857
3 L. monocytogenes K, N, NA, P, CN, E, SXT, CF, T, CP, AM 0.786
4 L. monocytogenes K, N, NA, P, CN, E, SXT, CF 0.571
5 L. monocytogenes K, N, NA, P, CN, E 0.428
6 L. monocytogenes K, N, NA, P, CN 0.357
7 L. monocytogenes K, N, NA 0.214
8 L. monocytogenes K, N 0.143
Average       0.535

Table 6: Antimicrobial resistance profile of L. monocytogenes strains. K: Kanamycin N: Neomycin, NA: Nalidixic acid, P: Penicillin G, CN: Cephalothin, E: Erythromycin, SXT: Sulphamethoxazol, CF: Cefotaxim, T: Oxytetracycline, CP: Ciprofloxacin, AM: Ampicillin, DO: Doxycycline, G: Gentamicin, AK: Amikacin, (number of L. monocytogenes isolates=8).

Acknowledgement

We acknowledge the technical and financial support provided by staff members of Food Control Department, Faculty of Veterinary Medicine, Zagazig University, Egypt.

Conflict of Interest

None.

References

Citation: Alaa Eldin MAM, Darwish WS, El-Sayed SEIS, Ali ELSM (2019) Rabbit Meat as a Possible Source for Multidrug Resistant Listeria monocytogenes. J Vet Sci Technol 10:579.

Copyright: © 2019 Alaa Eldin MAM, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Select your language of interest to view the total content in your interested language

Post Your Comment Citation
Share This Article
Article Usage
  • Total views: 481
  • [From(publication date): 0-0 - Sep 18, 2019]
  • Breakdown by view type
  • HTML page views: 430
  • PDF downloads: 51
Top