alexa Rapid Detection of NDM, VIM, KPC and IMP Carbapenemases by Real-Time PCR | Open Access Journals
ISSN: 2155-9597
Journal of Bacteriology & Parasitology
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Rapid Detection of NDM, VIM, KPC and IMP Carbapenemases by Real-Time PCR

Ewa Kosykowska*, Tomasz Dzieciątkowski and Grażyna Młynarczyk

Chart and Department of Medical Microbiology, Medical University of Warsaw, Warsaw, Poland

*Corresponding Author:
Ewa Kosykowska
Chart and Department of Medical Microbiology
Medical University of Warsaw
Warsaw, Poland
Tel: +48226282739
E-mail: ewa.kosykowska@wum.edu.pl

Received date: November 24, 2016; Accepted date: December 20, 2016; Published date: December 30, 2016

Citation: Ewa K, Tomasz D, Grazyna M (2016) Rapid Detection of NDM, VIM, KPC and IMP Carbapenemases by Real-Time PCR . J Bacteriol Parasitol 7:299. doi: 10.4172/2155-9597.1000299

Copyright: © 2016 Ewa K, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Bacteriology & Parasitology

Abstract

Carbapenems are the most potent beta-lactams, characterized by broad spectrum of activity against Gramnegative and Gram-positive bacteria. Unfortunately, the dynamic dispersal of carbapenem resistance among nonfermentative bacteria and Enterobacteriaceae is an over-increasing problem and might lead to dangerous limitation of treatment options. Among three different mechanisms of resistance the enzyme production is of special importance. In this case, only one small gene is enough to express carbapenem resistance. The carbapenemase genes are often a part of integrons, which carry diverse arrays of resistance gene cassettes and just one transfer event is enough to disseminate multidrug resistance. Moreover, carbapenemase genes are often located within Mobile Genetic Elements. For these reasons carbapenemases are the most epidemiologically importance. Early detection and identification of carbapenemase producers among clinical isolates can avoid nosocomial infections. We have developed a multiplex Real-Time PCR assay based on the TaqMan technology for rapid detection and identifications of the most common carbapenemases in Europe NDM, VIM, KPC and IMP. There were tested 31 isolates Enterobacteriaceae (n=15) and non-fermentative Gram-negative bacillary (n=16), which acquire NDM, VIM, KPC, IMP, GIM or OXAs carbapenemases. The whole elaborated experiment, including DNA isolation and PCR cycling, lasts up to 2 h.

Keywords

Carbapenemases detection; Real-Time PCR; NDM; VIM; KPC; IMP

Introduction

Emerging and dissemination of carbapenem-hydrolysing beta-lactamases among Enterobacteriaceae and non-fermentative Gram-negative bacillary such as Pseudomonas spp. or Acinetobacter baumannii over past decade is serious issue in the hospital environment. It is worthy to mention that carbapenemase producing organisms (CPOs) have primarily been recognized in hospitals but currently they are more and more common cause as well community infections [1]. Currently known mechanisms for carbapenem resistance among Gram-negative bacteria, involve decreased permeability by porins modifications, efflux pumps, increased natural cephalosporinase activity and the most frequent carbapenemase producing [2-4]. The carbapenemases hydrolyse almost all betalactams, are resistant to all therapeutically useful inhibitors and are coproduced with other beta-lactamases [5]. Moreover, carbapenemase genes are often a part of integrons, which carry diverse arrays of resistance gene cassettes. The most worrisome is the situation when such integron is located within some Mobile Genetic Elements (MGEs, transposons or transmissible plasmids). In this case just one transfer event is enough to disseminate multidrug resistance [1].

The most common carbapenemases in the world are NDM, VIM and IMP belonged to molecular class B and KPC, serine enzyme pertained to molecular class A [5].

Prevention of the dissemination of carbapenem resistant bacteria is of the utmost importance. Accurately identifying in the clinical laboratory is the first step in protection [1]. The purpose of the study has been to create the rapid method to detect such organisms. We have developed a multiplex real-time PCR (RT-PCR) assay, using TaqMan chemistry to detect just those species which possess some of the most frequent carbapenemases’ types VIM, IMP, NDM and/or KPC.

Materials and Methods

Bacterial strains

Thirty-one reference bacterial strains were obtained from the collection of the Chair and Department of Medical Microbiology, Medical University of Warsaw and used for detection in culture in order to validate the novel detection assay of bla VIM, blaIMP, bla NDM, blaKPC genes. All of the strains were clinical isolates tested by conventional PCR for several beta-lactamases genes (bla VIM, bla IMP, bla GIM, bla KPC, bla NDM; in case of Acinetobacter spp. also: bla OXA-23, bla OXA-24, bla OXA-51, bla OXA-58) [6-9]. The only one exception was NDM-1-positive E. coli DH5α created by synthesis of the bla NDM-1 gene (Epoch Life Science, USA) and transformation of the plasmid encoding this synthesized gene (pNDM_EK) into E. coli DH5α. Two strains (P. aeruginosa WUM_5 and P. aeruginosa WUM_6) came from the National Medicines Institute. All bacterial strains are described in details in Table 1. MICs were determined using Etest (bioMerieux).

Isolate no. Bacterium Genotype a MIC [µg/ml] Multiplex RT-PCR results
DOR b ETP b IMP b MER b 530 nm 610 nm
1 E.  coli WUM_1 blaNDM-1 ND ND ND ND + -
2 K. pneumoniae WUM_1 blaNDM 3 ND 16 4 + -
3 E. coli WUM_2 blaKPC 0,75 0,5 4 0,5 - +
4 E. coli WUM_2 blaKPC 24 >32 >32 >32 - +
5 K. oxytoca WUM_1 blaVIM, blaKPC 2 8 12 2 - +
6 K. oxytoca WUM_2 blaKPC 1 1,5 0,5 1 - +
7 K. pneumoniae WUM_2 blaKPC >32 >32 16 >32 - +
8 K. pneumoniae WUM_3 blaKPC >32 >32 >32 >32 - +
9 K. pneumoniae  WUM_4 blaKPC >32 >32 >32 >32 - +
10 K. pneumoniae WUM_5 blaKPC >32 >32 >32 >32 - +
11 K. pneumoniae WUM_6 blaKPC >32 >32 >32 >32 - +
12 K. pneumoniae WUM_7 blaKPC >32 >32 >32 >32 - +
13 K. pneumoniae WUM_8 blaKPC >32 >32 >32 >32 - +
14 E.  cloacae WUM_1 blaVIM 0,75 4 1,5 1,5 - +
15 P. aeruginosa WUM_1 blaVIM-2 16 ND 12 6 - +
16 P. aeruginosa WUM_2 blaVIM >32 ND >32 >32 - +
17 P. aeruginosa WUM_3 blaVIM 32 ND >32 >32 - +
18 P. aeruginosa WUM_4 blaVIM 32 ND >32 32 - +
19 P.  putida WUM_1 blaVIM 16 ND >32 >32 - +
20 S.  marcescens WUM_1 blaVIM >32 >32 >32 >32 - +
21 P. aeruginosa  WUM_5 blaIMP-1 >32 ND >32 >32 + -
22 P. aeruginosa WUM_6 blaGIM-1 >32 ND >32 >32 - -
23 A.  baumannii  WUM_1 blaOXA-24, blaOXA-51 >32 ND >32 >32 - -
24 A. baumannii  WUM_2 blaOXA-24, blaOXA-51 >32 ND >32 >32 - -
25 A. baumannii  WUM_3 blaOXA-24, blaOXA-51 >32 ND >32 >32 - -
26 A. baumannii  WUM_4 blaOXA-51, blaOXA-58 32 ND 32 32 - -
27 A. baumannii  WUM_5 blaOXA-51, blaOXA-58 12 ND 32 32 - -
28 A. baumannii  WUM_6 blaOXA-51 4 ND 6 8 - -
29 A. baumannii  WUM_7 blaOXA-51, blaOXA-58 24 ND >32 32 - -
30 A. baumannii  WUM_8 blaOXA-51 32 ND 32 32 - -
31 A.  junii WUM_1 blaOXA-58, blaVIM 2 ND 16 4 - +

Table 1: Results of multiplex RT-PCR and MICs of bacterial isolates used in this study. aGenotype was determined by conventional PCR in our labalatory; bDOR – doripenem; ETP – ertapenem; IMP - imipenem; MER – meropenem; ND - MICs not determined because of natural resistance for ertapenem Pseudomonas spp. and Acinetobacter spp. and in case of nonclinical isolate bla NDM-1 positive strain; + positive result; (-) negative result.

DNA extraction

DNA was isolated from bacterial colonies using the boiling lysis method. Strains were streaked onto Mueller Hinton (MH) agar and grown overnight at 37°C. A loopful of bacterial growth was suspended in 100 μl of sterile distilled water, incubated at room temperature for 5 min, and then boiled for 10 min. After centrifugation at 13200 rpm for 10 min, the pellet was discarded and the supernatant containing DNA was used directly for PCR or stored at -20°C [6].

Analytical specificity

Analytical specificity for each assay was verified using the following comprehensive panel of different beta-lactamases producers. We used five different species of Enterobacteriaceae : Escherichia coli, Enterobacter cloacae, Klebsiella oxytoca, Klebsiella pneumoniae, Serratia marcescens and four species of non-fermentative Gram-negative bacillary: Acinetobacter baumannii, Acinetobacter junii, Pseudomonas aeruginosaand Pseudomonas putida. All of them were beta-lactamases producers (described in details in Table 1).

Design of primers and TaqMan probes

All primers and probes were designed with using LightCycler Probe Design Software 2.0 (Roche Diagnostics). Reference sequence for each of five genes was assembled from GeneBank (accession numbers: JF966383.1; JX104759.1; GU831553.1; AB182996.1; JQ060896.1). Sequence specificity was confirmed in sillico by nucleotide-nucleotide search in the National Centre for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov/blaST/). The detailed sequences of used primers and probes are described in Table 2.

Target Primer/probe name Sequence (5’ → 3’) Amplicon size (bp) Concentration [µM] Reference sequenceb
blaVIM VIMf TCTCCACGCACTTTCATGAC 124 2 JF966383.1
VIMr2 GTGGGAATCTCGTTCCCCTC   2  
s_qVIM LC.red 610 -GGCAACGTACGCATCACCGTC- BHQ-2 a   1,5  
blaKPC KPCf ATATCTGACAACAGGCATGAC 95 1,75 JX104759.1
KPCr CCAACTCCTTCAGCAACAAA   1,75  
s_qKPC LC.red 610 -AATACAGTGATAACGCCGCCG- BHQ-2   1,5  
blaIMP-1 like IMP1f GGCTTAATTCTCGATCTATCCC 114 1,75 GU831553.1
IMP1r CTAGCCAATAGTTAACTCCGC   1,75  
s_qIMP1 FAM -GACGGTAAGGTTCAAGCCACAAAT- BHQ-1   1,5  
blaIMP-2 like IMP2f TAGAGTGGCTTAATTCTCAATCTATTCC 120 2 AB182996.1
IMP2r CTAGCCAATAACTAACTCCGC   2  
s_qIMP2 FAM -AACTTCTTAAAAAAGACGGTAAGGTGCA- BHQ-1   1,5  
blaNDM NDM1f2 GATCCTCAACTGGATCAAGC 128 2,25 JQ060896.1
NDM1r2 CATTGGCATAAGTCGCAATC   2,25  
s_qNDM FAM -GACTCACGCGCATCAGGACAA- BHQ-1   1,5  

Table 2: Primers and probes used in this study. a Probes’ 5’ reporter and 3’ quencher dyes are bolded. b Gene Bank accession no.

Real-Time PCR

Investigations were performed using amplification mixture TaqMan Master Kit® (Roche Diagnostics). Besides chemicals supplied by kit producer, reaction mixture contained 1 μl of template DNA, 1,5 μM of each probe, 1,75; 2 or 2,25 μM of adequate primers (as described in Table 2) in a final volume of 10 μl. The best results of amplification were obtained with: activation of thermostable hot-start DNA polymerase for 10 min at 95°C, followed by 40 cycles comprising: denaturation (10 s at 95°C), primers annealing (10 s at 60°C) and strand elongation (15 s at 72°C). After the end of cycling, material was cooled down to 40°C for 60 s. Fluorescence levels were measured at wavelengths: 530 nm (FAM dye) and 610 nm (LC-Red 610 dye). The limit of detection (LOD) of each assay was determined by analysis of serial decimal dilutions of used DNA in range 101-106 copies. Each dilution was prepared and analyzed in six independent replications. Probity analysis was used to calculate the LOD concentration [10].

All described experiments were performed in two independent repetitions, using LightCycler 2.0 instrument (Roche Diagnostics).

Interpretation of results

A sample was considered positive by RT-PCR if it crossed the threshold before a crossing point (Cp ) of 35 cycle and negative if the Cp was greater than 35. Positive result at wavelength 530 nm (FAM dye) stated the presence of bla IMP or bla NDM, whereas positive result at wavelength 610 nm (LC-Red 610 dye) meant the presence of bla VIM or bla KPC.

Results

Designed primers and probe of the bla KPC amplicon in silico show total identity to all 12 alleles (bla KPC-2 to bla KPC-13). Likewise, NDM1f, NDM1r primers and s_qNDM probe are identical to all known bla NDM (bla NDM-1-7) alleles. Amplicon VIM covers most of the 33 alleles but not all. However, the most common VIM alleles are detectable. VIMf, VIMr primers and s_qVIM probe are identical to regions of blaVIM-1, 2, 4, 5, 8, 9, 10, 12, 14-17, 19-33 alleles. bla VIM-3, 6, 7, 11, 13 alleles have from one to five single nucleotide polymorphisms (SNPs) within these regions which are covered by those three oligonucleotides. bla VIM-18 allele has 12 nt deletion in the region which covers VIMr primer. bla IMP-like genes are much more diverse than the others and we decided to design two amplicons. Such solution allowed to detect the majority of the most frequent bla IMP alleles. IMP-1f, IMP-1r primers and s_qIMP1 probe are identical to bla IMP-1, 3, 6, 10, 25 and 30 alleles. IMP-2f, IMP-2r primers and s_qIMP2 probe are identical to bla IMP-2, 8, 19, 20 and 24 alleles.

Analytical specificity

The specificity of the primers and probes for the detection of all investigated genes were evaluated by the blaST search program, available at www.ncbi.nlm.nih.gov. No matches to the primers and probe sequences other than those which were investigated were found.

Additionally, to verify analytical specificity, the multiplex RT-PCR assay was checked in 31 DNA templates from nine different Gram-negative species, beta-lactamases producers (described in details in Table 2) and the results are in accordance with expected. No cross-reactivity or nonspecific amplification was observed for any of the assays tested with these tested organisms.

After positive result, it is recommended to conduct the next RT-PCR with single pair of primers (monoplex RT-PCR) to find out which exactly carbapenemase tested isolate contains. For example, if tested strain revealed signal on 610 nm, it is worthy to conduct two independent reactions with KPC primers and probes and with VIM oligonucteotides. Differentiation of carbapenemase type is also possible by cheaper and time-consuming methods such as phenotypic tests. The results of LOD in developed RT-PCR assays, determined in DNA copies per reaction tube are shown in Table 3 (supplementary information).

Detected gene in a given RT-PCR assay LOD (DNA copies/reaction) 95% confidence interval (DNA copies/reaction)
bla KPC 107 81-129
bla IMP-1 56 44-67
bla NDM-1 194 175-231
bla VIM-2 98 82-113

Table 3: Limits of detection (LOD) of the RT-PCR assays.

Discussion

Early identification of carbapenemase producing organisms (CPOs) among clinical isolates should be obligatory to prevent their prevalence. Infections caused by CPOs are the most worrisome because of the high mortality rate. Additionally, carbapenemases genes might disperse rapidly among intestinal microbiota and others bacteria especially easily in hospital environments under antibiotic selective pressure [11].

In the routine laboratory, detection of carbapenem resistant isolates is mainly based on phenotypic methods such as double-disk test (DDT) with EDTA inhibitor to detect metalo-beta-lactamases (MBLs) producers and modified Hodge test (MHT) with phenyl boronic acid as an inhibitor to detect KPC-positive bacteria or modifications of above-mentioned tests [12,13]. Temocillin susceptibility is ascertaining to identify OXA-48 producers. These phenotypic methods characterised by different specificity and sensitivity often need technical changes and are time-consuming. Currently, there are commercially available more convenient phenotypic method, Etest to detect MBL producers and the other one for KPC identification [14,15]. Recently, many different methods are evaluated to detect CPOs but without differentiation into enzyme type. The first step is similarly in all methods described below. It is based on the in vitro hydrolysis of carbapenem (imipenem, meropenem, ertapenem, less doripenem) by bacterial colonies or their extract. The detection of decreased carbapenem concentration is performed by several different manners. Matrix assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (MS) assays reveals others view in mass spectra of the beta-lactam molecule, its salts, and/or its degradation products [16,17]. Hydrolysis of beta-lactam may be conduct with using a bacterial culture or the extract. CarbaNP is a biochemical test for detection of CPOs directly from bacterial culture, which is detected by changes in pH values revealed by the indicator bromothymol blue [18]. Carbapenem inactivation method (CIM) is a cost-effective and highly robust method. After incubation disc containing meropenem with tested strain the disc is plated on MH agar plate inoculated with a susceptible E. coli indicator strain. If the tested strain produced a carbapenemase, the meropenem was inactivated allowing uninhibited growth of the E. coli indicator strain [19]. Protocol for spectrophotometric detection is more time-consuming and labor-intensive than methods above. After 18 h incubation, double centrifugations and sonication the supernatant is used to test for its hydrolysis activity by UV spectrophotometry using imipenem as a substrate at a wavelength of 297 nm [20].

The new, described method in confrontation to other available in literature such as multiplex RT-PCR with melting curves described by Monteiro or Hofko is a little more expensive but the results are more unequivocal [21,22]. Similarly, Nijhuis provided a multiplex RT-PCR to detect carbapenemase genes by using molecular beacon probes, which are more difficult with interpretations than TaqMan probes [23].

According to our knowledge, this is the first report of a multiplex RT-PCR assay with TaqMan probes to detect such set of enzymes, dedicated for Enterobacteriaceae and non-fermentative bacilli. The experiment is easy to conduct and lasts only about 1 h. Unfortunately, expensive equipment and reagents are required therefore it is solution only for specialist laboratories.

In conclusion, we have described a multiplex RT-PCR assay for identification and partial classification of four selected carbapenemases: VIM, IMP, NDM and KPC. The whole experiment, including DNA isolation and PCR cycling, lasts up to 2 h.

Acknowledgements

We are grateful to National Medicines Institute for providing the two bacterial strains P. aeruginosa WUM_5 and P. aeruginosa WUM_6.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 781
  • [From(publication date):
    December-2016 - Apr 29, 2017]
  • Breakdown by view type
  • HTML page views : 710
  • PDF downloads :71
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

agrifoodaquavet@omicsonline.com

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

clinical_biochem@omicsonline.com

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

business@omicsonline.com

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

chemicaleng_chemistry@omicsonline.com

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

environmentalsci@omicsonline.com

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

engineering@omicsonline.com

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

generalsci_healthcare@omicsonline.com

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

genetics_molbio@omicsonline.com

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

immuno_microbio@omicsonline.com

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

omics@omicsonline.com

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

materialsci@omicsonline.com

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

mathematics_physics@omicsonline.com

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

medical@omicsonline.com

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

neuro_psychology@omicsonline.com

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

pharma@omicsonline.com

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

social_politicalsci@omicsonline.com

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version