alexa Serum Amyloid A4 and Ceruloplasmin Evaluated Mastitic Cattle with Escherichia coli or Staphylococcus aureus including Resistant Genes | Open Access Journals
ISSN: 1948-593X
Journal of Bioanalysis & Biomedicine
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Serum Amyloid A4 and Ceruloplasmin Evaluated Mastitic Cattle with Escherichia coli or Staphylococcus aureus including Resistant Genes

Verginia Mohamed El-Metwally Farag1*, Amany Mohamed Abd-El-Moaty2, Nermin Awad Ibrahim2, Samar Magdy Atwa3 and Mohamed Abd-EL-Naeem EL-Beskawy3

1Department of Clinical Pathology, Mansoura University, Egypt

2Department of Bacteriology, Mycology and Immunology, Mansoura University, Egypt

3Department of Internal Medicine, Infectious and Fish Diseases (Infectious Diseases), Mansoura University, Egypt

*Corresponding Author:
Verginia Mohamed El-Metwally Farag
Department of Clinical Pathology, Faculty of Veterinary Medicine
Mansoura University, Egypt
Tel: 02201126210224
E-mail: [email protected]

Received date: May 14, 2017; Accepted date: May 29, 2017; Published date: June 05, 2017

Citation: Farag VMEM, Abd-El-Moaty AM, Ibrahim NA, Atwa SM, EL-Beskawy MA (2017) Serum Amyloid A4 and Ceruloplasmin Evaluated Mastitic Cattle with Escherichia coli or Staphylococcus aureus including Resistant Genes. J Bioanal Biomed 9:132-136. doi: 10.4172/1948-593X.1000167

Copyright: © 2017 Farag VMEM, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Bioanalysis & Biomedicine

Abstract

This study investigated the prevalence of an important Gram-negative and a Gram-positive bacterial strain, as well as the test on a few antibiotic resistant genes and sensitivity on the two bacteria. Moreover, the relations of the two microorganisms with some Acute Phase Proteins (APPs) inflammatory marker such as Serum Amyloid A (SAA) and Ceruloplasmin (Cp) in serum and milk were inspected. Out of 120 samples of Mastitic cow’s milk were identified 19.2% Escherichia coli (E. coli) and 14.2% Staphylococcus aureus (S. aureus) single isolates. Isolates of E. coli were completely sensitive to imipenem followed by meropenem then amikacin, enrofloxacin, gentamicin and cefoprazone. Two out of four isolates of multidrug resistance (against cefotaxime, penicillin, cefoprazone and gentamicin) showed positive amplification for beta lactam encoded gene blaTEM. Furthermore two isolates (out of four) resisted tetracycline were positive for TetA (A) gene. In S. aureus isolates, resistance was gradually increased from amikacin, tetracycline, and cefotaxime to oxacillin till reached 100% against penicillin. All analyzed eight isolates of penicillin resistance carried blaZ gene. Likewise, Methicillin A (mecA) gene was positive in six out of eight isolates of oxacillin resistance group. Results of SAA4 and Cp levels were differed in both pathogen groups. For E. coli group, the two levels were significantly increased in serum and only Cp elevated in milk comparing with control group. Conversely, in case of S. aureus, both parameters elevated significantly in milk and only SAA4 level was significant elevated in serum.

In conclusion, resistance to β-Lactam group, methicillin resistant group and tetracycline has reached a critical level in mastitic cattle with E. coli and S. aureus. But still the most effective and available antibiotics were enrofloxacin, amikacin and gentamicin. For diagnosis, SAA4 and Cp level has helped as a rapid tool in differentiation between both organisms.

Keywords

Mastitis; Cattle; Resistant gene; Escherichia coli; Staphylococcus aureus; SAA4; Ceruloplasmin

Introduction

Bovine mastitis is an inflammatory infectious disease of mammary glands and has difficulty to overcome. It affects normal milk flow and quality. Enterobacteriaceae (as Escherichia coli) and Staphylococcus bacteria species are one of the most problematic bacteria caused bovine mastitis [1]. They have a developing resistance for antibiotics especially for β-Lactam group (penicillin, cephalosporins, monobactams and carbactams) [2].

Prevalence of E. coli and multidrug resistance is of great concern in many countries especially in North Africa. Resistance to penicillin, tetracycline and sulphonamides and extension to β-lactamase spectrum in bovine mastitis are recorded in many reports [3-5]. Antimicrobial resistance genes extend to β-lactam group and tetracycline in E. coli. The blaTEM is an important gene of E. coli livestock [3]. Furthermore, mecA gene is encoded penicillin-binding protein 2A and cause methicillin resistance in Staphylococcus aureus [4].

Acute APPs are hepatic non-structurally related proteins in different body fluid and are diagnostic for inflammation in dairy cattle [6]. However, not all diseases change the APPs level. Mammary SAA-3 had antibacterial activity [7]. Serum amyloid A is one of the APPs. It had many highly linked genes (SAA1, SAA2, SAA3 and SAA4) [8]. Mammary SAA-3 had antibacterial activity [7] and activates the involution via increasing cytokines related to innate immunity in cattle infected with S. aureus [9,10]. Also, ceruloplasmin is one of the APPs protect the cell from danger of oxygen species. However, the relation between pathogen and APPs in mastitic cattle needs more studies [11].

Present study investigated prevalence of mastitic cattle with E. coli and S. aureus including resistance genes and susceptibility to some antibiotics with diagnostic reference of SAA4 and Cp levels in serum and milk.

Materials and Methods

Samples collection

The study was done on milk and corresponding blood samples (from the jugular vein) of 120 mastitic Holstein cows (3-7 years of age) diagnosed in the veterinary hospital, faculty of veterinary medicine, Mansoura University, Dakahlia Governorate, Egypt in two years (2014 and 2015). Each sample was taken from one animal and one quarter (most inflamed), changed milk (watery or viscous and yellowish or tinged with blood). Hand milking samples (10 mL of each) were collected in sterile vials after teat disinfection (70% ethanol) and discarding the first milk jets and directly conveyed to the laboratory. Blood samples tubes were put in an inclined position (20 min at room temperature) then in the refrigerator (one h) for improving the clot. All samples were centrifuged at 5000 and 3000 rpm for 30 and 10 min for milk and serum respectively. Milk samples precipitates were used for bacteriological examination. The clear blood serum and milk supernatant were kept at -20°C till used. California Mastitis test was negative for control group samples (from clinically healthy cows). After bacteriological identification, random ten samples of serum and corresponding milk were taken from each S. aureus and E. coli positive groups rather than control one for SAA4 and Cp analysis.

Bacteriological analysis and isolates identification

Milk samples precipitate was used for microbial enrichment procedure [12]. MacConkey agar (Biomark, Pune) and Eosin Methylene Blue (EMB) agar (Oxoid) for obtaining pure E. coli colonies (appeared as metallic sheen green colonies on EMB). For obtaining S. aureus isolates, inoculum were streaked on Bairdparker agar media (Oxoid) containing Egg yolk tellurite emulsion (5%) (Oxoid). The colony was seen as grey black and Gram stain film showed gram-positive cocci in bunched grape like irregular clusters. While E. coli appeared as gram-negative, large, pink, rod shaped. Then all suspected colonies were conducted to rapid identification by VITEK 2 compact system (Biomerieux) at the institute of animal health research, Dokki, Cairo, Egypt.

Antibiotic susceptibility assay

All E. coli and S. aureus isolates were subjected to antibiotic susceptibility tests using disk diffusion method [13] on Muller Hinton agar (Oxoid). The visible clear inhibition zone was determined (mm) and interpreted according guidelines chart. The isolates were graded for resistance to three or more antibiotics were recorded as multiple antibiotic resistant [14]. The antimicrobial discs (Oxoid) used were penicillin, enrofloxacin, amikacin, cefotaxime, cefoperazon, meropenem, imipenem, gentamicin, tetracycline and oxacillin.

DNA extraction and PCR amplification

Extraction of DNA from isolates was done using Mini kit of QIAamp DNA (Qiagen, Germany, GmbH) followed the manufactured instructions. Amplification of the PCR was done using oligonucleotide primers (supplied from Metabion, Germany) listed in Table 1. The primers were utilized in a reaction containing Emerald Amp Max PCR Master Mix (Takara, Japan). A functional thermal cycler biosystem 2720 was used.

Target gene Primers sequences Ampl.
segment (bp)
Prim.
Denat.
Amplification (35 cycles) Final exten. Ref.
Sec.
Denat.
Ann. Exten.
Staphylococcus aureus blaZ ACTTCAACACCTGCTGCTTTC 173 94?C
5min
94?C
30 s
54?C
30 s
72?C
30 s
72?C
7min
[37]
TGACCACTTTTATCAGCAACC
Staphylococcus aureus mecA GTAGAAATGACTGAACGTCCGATAA 310 94?C
5 min
94?C
45  s
50?C
45  s
72?C
45  s
72?C
10 min
[38]
CCAATTCCACATTGTTTCGGTCTAA
Escherichia coli blaTEM ATCAGCAATAAACCAGC 516 94?C
10 min
94?C
45  s
54?C
45  s
72?C
45  s
72?C
10 min
[39]
CCCCGAAGAACGTTTTC
Escherichia coli TetA GGTTCACTCGAACGACGTCA 576 bp 94?C
5 min
94?C
45  s
50?C
45  s
72?C
45  s
72?C
7 min
[40]
CTGTCCGACAAGTTGCATGA

Table 1: The target genes, sequences of primers, sizes of amplification and cycling conditions in Staphylococcus aureus and Escherichia coli bacteria isolated from mastitic Holstein cattle (3-7 years old) milk in 2014-2015.

Analysis of the Polymerase Chain Reaction (PCR) products

By electrophoresis separation, PCR products analysis was prepared on agarose gel (Applichem, Germany, GmbH) in 1X TBE buffer (at room temperature). The DNA Ladders (Qiagen, Germany, GmbH) have been used. Photographing the gel was done via gel documentation system (Alpha Innotech, Biometra) computer software analyzed.

Bovine SAA4 and Cp analysis

Serum and milk SAA4 and Cp concentrations were determined in faculty of medicine, Cairo University, Egypt, using commercial Enzyme-Linked Immunosorbent Assay (ELISA) Kits (for serum). Quantitative immunoassay techniques were used for determination of bovine SAA4 (Nori bovine SAA4 ELISA Kit, Genorise Scientific, INC., USA, Cat. GRC112079) and bovine Cp (MyBioSource, Cat. No. MBS 703493). Samples were analyzed in duplicate following the manufacturer’s instructions.

Statistical analysis

The biochemical parameters were statistically analyzed by using SPSS 17.0 program for windows, analysis of variance (ANOVA), LSD test for defining the statistical significance. Data were presented as means ± Standard Deviations (SD).

Results

Prevalence and bacteriological identification

Single bacterial isolates of Escherichia coli and Staphylococcus aureus were constituted 23 (19.2%) and 17 (14.2%) of 120 mastitic milk samples respectively. Meanwhile the mixed infection was 35 (29.16%) isolates.

Antibiotic susceptibility assay

Multidrug resistance of E. coli were 9 out of 23 isolates; three (for penicillin, cefotaxime, and tetracycline), four (for cefotaxime, penicillin, cefoprazone and gentamicin) and two (for penicillin, cefotaxime and amikacin). Table 2 demonstrates antibiotic susceptibility for E. coli.

Antibiotic Susceptible Intermediate Resistant
Number % Number % Number %
Penicillin - - 3 13.04 20 86.9
Enrofloxacin 18 78.26 5 21.73 - -
Amikacin 19 82.60 2 8.69 2 8.69
Cefotaxime - - 7 30.43 15 65.21
Cefoprazone 15 65.21 5 21.73 5 21.73
Imipenem 23 100 - - - -
Meropenem 20 86.95 3 13.04 - -
Gentamicin 17 73.91 4 17.39 2 8.69
Tetracycline 5 21.73 4 17.39 14 60.86
Oxacillin 5 21.73 8 34.78 10 43.47

Table 2: Results of antibiotic sensitivity test of Escherichia coli milk samples (n=23) of mastitic Holstein cattle (3–7 years of age) in 2014-2015.

Regarding to S. aureus, multidrug resistance was eight out of 17 (penicillin, oxacillin and cefotaxime) isolates. Antibiotic susceptibility of S. aureus isolates were tabulated (Table 3).

Antibiotic Susceptible Intermediate Resistant
Number % Number % Number %
Penicillin _       17 100
Enrofloxacin 16 94.11 1 5.88 _  
Amikacin 10 58.82 2 11.76 5 29.41
Cefotaxime 7 41.17 3 17.64 8 47.58
Cefoprazone 12 70.58 5 29.41 _  
Imipenem 16 94.11 1 5.88 _  
Meropenem 14 82.35 3 17.64 _  
Gentamicin 13 76.47 4 23.52 _  
Tetracycline 10 58.82 2 11.76 7 41.17
Oxacillin 5 29.41 3 17.64 9 52.94

Table 3: Results of antibiotic sensitivity test of Staphylococcus aureus milk samples (n=17) of mastitic Holstein cattle (3–7 years of age) in 2014-2015.

Gene detection

Two out of four E. coli isolates carried bla TEM (516 bp) gene. These isolates resisted cefotaxime, penicillin, cefoprazone and gentamicin. TetA (A) (576 bp) gene was present in two out of four isolates resisted to tetracycline (Figure 1).

bioanalysis-biomedicine-Detection-tetracyclin

Figure 1: Detection of tetracyclin A (TetA (A)) and β lactam (βlaTEM) genes in Escherichia coli isolated from milk of mastitic Holstein cattle (3–7 years of age) in 2014-2015.

Concerning to S. aureus isolates, positive amplification of blaZ (173) gene was investigated in all eight isolates resisted to penicillin group. Also, there were six out of eight (75%) isolates resisted to oxacillin group were positive for mecA (310 bp) gene (Figure 2).

bioanalysis-biomedicine-mecA-blaZ-genes

Figure 2: Detection of mecA and blaZ genes in Staphylococcus aureus isolated from milk of mastitic Holstein cattle (3–7 years of age) in 2014-2015.

Bovine SAA4 and Cp analysis

As shown in Table 4, in E. coli group, both SAA and Cp levels increased significantly in serum meanwhile Cp increased significantly in milk only as compared to control group. While, in S. aureus group, each parameter level elevated significantly in milk while only SAA level elevated in serum in comparative with control one.

Parameters Groups
Control Escherichia coli Staphylococcus aureus
Blood
SAA4 (mg/dL) 17.56 ± 4.33b 23.61 ± 7.29a 22.23 ± 2.27a
Cp (mg/dL) 24.44 ± 3.40b 33.61 ± 13.17a 25.63 ± 8.44ab
Milk
SAA4 (mg/dL) 2.15 ± 0.13b 2.53 ± 0.63ab 2.88 ± 0.40a
Cp (mg/dL) 6.06 ± 0.47b 7.18 ± 1.57a 7.34 ± 0.60a

Table 4: Serum Amyloid A4 (SAA4) and Ceruloplasmin (Cp) concentration (mean ± SD) in blood serum and milk of mastitic Holstein cattle (3–7 years of age) infected with Escherichia coli and Staphylococcus aureus in 2014-2015.

Discussion

Escherichia coli and Staphylococcus aureus constitute important cause of contagious and environmental mastitis in dairy cattle respectively [15]. Regarding to E. coli isolates, the present results were closely like to results (17.82%) of clinical mastitis study in Egypt [16] but higher than others in Slovakia [17] and in Uganda [18].

Prevalence percent of S. aureus isolates was nearly similar as a study in Egypt (11 isolates of 86) [19], contraries, another study [17] establish moderately low percent (9.74%). The differences are due to variations in management or season, as well immunity and closed houses in winter are of a great concern [15]. Also, current study selected only single isolates of both microorganisms.

Haphazard usage of antimicrobial agents in treatment of mastitis affected the resistance of E. coli and S. aureus isolates [17]. Susceptibility results were agreed with Chandrasekaran et al. [20] for E. coli isolates. For S. aureus, results were closely agreed with Beyene [21] and nearly (57.14%) with others [22]. Staphylococcus spp. resisted methicillin was attributed to β-lactamase and penicillin binding protein production [23] and blaZ gene was responsible for β-lactamase production [24].

In serum, present elevation level of SAA did not differ from previous reports [7,25] except in percentage which may differed according to the severity or chronicity of disease or isoforms nature with strong correlation with mammary cells [26]. But, its elevation in milk was confused. With serum ELISA kits, it did not change in serum and milk, while it varied with milk ELISA kits [27].

In general, inflamed mammary tissue raise the permeability of blood vessels and leakage of APPs to the milk flow [28]. The SAA improved chemotaxis (movement in response to chemical substance) of monocyte and neutrophil and opsonization (adsorption to facilitate adhesion to bacteria) for further phagocytosis as well as getting rid of the endotoxins [29]. Further, not only type of pathogen (as E. coli and S. aureus) affects SAA level [25] but different strains of S. aureus are also inducing variable response in vitro in bovine mammary cells [26]. Consequently, SAA may be included for screening cows’ mastitis [30,31].

Ceruloplasmin level elevated with the two studied mastitic groups. It is a major source of copper which has excellent anti-oxidative properties against inflammation and infection [32]. All aerobic microorganisms need copper. Meanwhile, when copper exceed the normal limit, it possesses two cycling ability in two oxidation process makes it very toxic for bacteria in assistance with the host macrophage which is copper dependent [33]. Moreover, Cp activates pathogen recognition in dairy cows that intramammary challenged with E. coli lipopolysaccharide [34]. Similarly, when treating mammary epithelial cells of murine with E. coli endotoxin or lipopolysaccharide S. aureus, up-regulation and transportation of some inflammatory marker genes are affected [35]. Both milk Cp and SAA levels depend on the method of measurement to be diagnostic tools for subclinical mastitis and many inflammatory diseases in dairy cattle [7,36].

In conclusion, prevalence of E. coli and S. aureus isolates was high in mastitic cattle of the studied samples and affect human life. High percent of the isolates resistance genes confirmed antibiotics problem particularly against methicillin resistance groups and multidrug resistance that was dramatically growing. Consequently the chance of treatment was decreased by excluding some important drugs such as penicillin then cefotaxime and oxacillin. On the other hand the diagnosis appeared to be helpful via determination of SAA and Cp in serum and milk. They may be included to quick differentiation between the two microbes and save time for correct treatment [37-40].

Acknowledgements

Authors acknowledged departments of clinical pathology and internal medicine, infectious diseases and fish diseases (infectious disease) faculty of veterinary medicine, Mansoura University, Egypt for encouragement and supplying of chemicals and devices.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Article Usage

  • Total views: 355
  • [From(publication date):
    June-2017 - Sep 27, 2017]
  • Breakdown by view type
  • HTML page views : 309
  • PDF downloads :46
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords