alexa SIRT1, IGFBP-3 and CAV1 Promoter DNA Methylation in Aging | Open Access Journals
ISSN: 2161-1025
Translational Medicine
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

SIRT1, IGFBP-3 and CAV1 Promoter DNA Methylation in Aging

Carolina Oliveira Gigek1*, Luara Carolina Frias Lisboa1, Patricia Natalia Oliveira Silva1, Mariana Ferreira Leal1, Roger W de Labio2, Spencer Luiz Marques Payão2 and Marilia de Arruda Cardoso Smith1

1Discipline of Genetics, Department of Morphology and Genetics, Federal University of São Paulo, SP, Brazil

2Laboratory of Genetics, Blood Center, Faculty of Medicine of Marilia (FAMEMA), Marilia, SP, Brazil

*Corresponding Author:
Carolina de Oliveira Gigek
Paulista School of Medicine
Federal University of Sao Paulo
(UNIFESP)Rua Botucatu 740, Ed Leitao da Cunha
04023-900, Sao Paulo - SP – Brazil
Tel: 55 (11) 55764260
Fax: 55 (11) 55764264
E-mail: [email protected]

Received Date: May 16, 2014; Accepted Date: June 27, 2014; Published Date: July 01, 2014

Citation: Gigek CO, Lisboa LCF, Silva PNO, Leal MF, de Labio RW, et al. (2014) SIRT1, IGFBP-3 and CAV1 Promoter DNA Methylation in Aging . Transl Med (Sunnyvale) 4:133. doi:10.4172/2161-1025.1000133

Copyright: © 2014 Gigek CO, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Translational Medicine

Abstract

The human genome is a fragile and highly conserved structure that accumulates a wide range of damaging alterations with age. Long-term alterations in the transcriptional potential of a cell are heritable and these changes are called epigenetics. The most studied alteration is the DNA methylation, which can regulate gene expression, often blocking gene transcription. The relationship between epigenetics and aging was proposed many years ago, and a decrease in the genomic global DNA methylation with age was largely observed. In this study we describe the methylation status of SIRT1, IGFBP-3 and CAV1 in a young and an older group of healthy individuals by methylation-specific PCR. SIRT1and IGFBP-3 promoter methylation frequency was significantly higher in the older than in the young adult group. Moreover, when combining promoter methylation status of several genes we observed that the total number of methylated promoters more than 85% of older individuals presented 4 promoters against only 46% of young adults. These findings may suggest that with increasing age there is an epigenetic switching to gene repression. The understanding of age-related genes methylation status can lead to a better comprehension of the role of epigenetic variation in the aging process.

Keywords

Aging; DNA methylation; Epigenetic; SIRT1; CAV1; IGFBP-3

Introduction

Epigenetic is defined as heritable changes in gene activity and expression [1]. The most known epigenetic modifications are DNA methylation and histone post-transcriptional modifications. DNA methylation consists of the addition of a methyl group to the aromatic ring of 5-carbon of the cytosine ring of a CpG dinucleotide. This dinucleotide is concentrated in particular gene promoters, called CpG islands, where it can regulate gene expression, often blocking transcription when the methyl group is present [1].

The human genome is a fragile and highly conserved structure that accumulates a wide range of damaging alterations with age, despite continuous surveillance and repair [2]. In addition to this global hypomethylation, a number of specific loci have been described as hypermethylated during aging [1]. Interesting, this events are known epigenetic alterations in cancer, which suggests that the accumulation of epigenetic alterations during aging may directly contribute to malignant transformation [3].

A recent paper describes an appealing predictor of age that estimates the DNA methylation age of most tissues. The author proposes that DNA methylation age measures the cumulative effect of an epigenetic maintenance system very useful for developmental biology, cancer and aging research [4].

In this study, we selected three genes, SIRT1, IGFBP-3 and CAV-1, to evaluate DNA promoter methylation in the aging process. To our knowledge, this is the first study of DNA promoter methylation in these genes in normal aging process.

Material and Methods

Samples

Methylation status of SIRT1, IGFBP-3 and CAV-1 were evaluated in peripheral blood samples of two groups: 1) Older Adults, including about 50 healthy older adults, with exclusion criteria for depression, stroke, dementia and low cognitive levels using Mini-Mental State Exam (MMSE), 2) Younger Adults including about 60 healthy young adult volunteers. Mean age for groups were 70.06 ± 9.644 years and 21.46 ± 2.482 years, respectively. All older individuals were selected at Neurology Department of Federal University of São Paulo. All individuals signed a written informed consent form.

DNA extraction and Methylation Specific PCR (MSP)

DNA extraction was performed using the QIAamp DNA Blood Midi Kit (Qiagen). To evaluate methylation status, genomic DNA (200 ng) of all samples underwent bisulfite modification using EpiTect Bisulfite kit (Qiagen, Germany) according to the manufacturer’s instructions. Specific primers for MSP, located within the genes’ promoter, are described in Table 1. Briefly, PCR reaction was carried out in a 25 μL volume with 200 μmol/L of MgCl2, 100 ng of DNA, 200 pmol/L of primers and 1.25 units of Taq (LGC, Brazil). After initial denaturating for 5 min at 94ºC, 40 cycles at 94ºC for 45 s, at respectively temperature (Table 1) for 45 s, and at 72ºC for 30 s were carried out, followed by a final extension for 5 min at 72ºC. Results were scored when there was a clear and visible band on the electrophoresis gel with the methylated and unmethylated primers [5] (Figure 1).

Gene Sense Anti-sense Product Tm (°C)
SIRT1 M- GGCGAATTTGGTTGTATTATACG
U- GGGGTGAATTTGGTTGTATTATATG
M- GAACGAAAACTATTACGTCTACCG
U- AAACAAAAACTATTACATCTACCACT
110bp
112bp
62.2
IGFBP-3 M-TTTCGGTTTTTATATAGCGGTC
U-TTATTTTGGTTTTTATATAGTGGTT
M-AAAAAACGACTAATCCTCAACG
U-AACAAAAAACAACTAATCCTCAACA
84pb
90pb
54.1
CAV-1 M-TTTCGGGACGTTTTTCGGTGGT
U-GAAAATATTTGTTTTTTTTGGGAT
M-TAAAAACGTTTCTCCCGCGCTA
U-ACAAATAAAAACATTTCTCCCACA
96bp
116bp
57.8

Table 1: Primers sequences, product size and annealing temperature for SIRT1, IGFBP-3 and CAV-1 used in methylation specific PCR

translational-medicine-methylation-gene-promoters

Figure 1: Methylation analysis by MSP of gene promoters: a) SIRT1 showing unmethylated samples (01 and 02) b) IGFBP-3 showing unmethylated (03 and methylated samples (04) c) CAV1 showing methylated samples (05 and 06). L: size marker; M: methylated; U: unmethylated

Statistical analyses

Statistical analyses were performed using the χ2 test or Fisher’s exact test to assess associations between methylation status and the two groups. P values less than 0.05 were considered significant.

Results

SIRT1 promoter methylation was more frequently observed in the older than in the young adult group (p=0.024) (Table 2). IGFBP-3 also presented promoter hypermethylation in 88% of older group and in 68.9% of younger group (p=0.022).

  Unmethylated(%) Methylated (%) p
SIRT1     0.024*
Young Adults 58 (98.3%) 1 (1.7%)
Older Adults 44 (86.3%) 7 (13.7%)
       
IGFBP-3     0.022*
Young Adults 19 (31.1%) 42 (68.9%)
Older Adults 6 (12%) 44 (88%)
       
CAV1     0.288
Young Adults 6 (10.3%) 52 (89.7%)
Older Adults 2 (4.2%) 46 (95.8%)

Table 2: Methylation frequency of SIRT1, IGFBP-3 and CAV1 promoter by groups, n (%)

The methylation pattern of CAV-1 did not differ between groups (p=0.288) (Table 2). Also, no statistical differences were observed for gender for IGFBP-3 (p=0.813), SIRT1 (p=1) and CAV1 (p=0.256).

Moreover, when combining SIRT1, IGFBP3 and CAV1 methylation analyses with previous data published by our group by Silva et al. [6], that studied methylation status of SIRT3, SMARCA5, hTERT and CDH1 in the same sample, we observed that the total numbers of methylated promoters are significantly higher in the older group than in the young control group. More than 85% of aged individuals presented 4 or more methylated gene promoters against only 46% of young adults (p=0.001) (Figure 2).

translational-medicine-young-adults-methylated

Figure 2: Graph showing percentage of young adults and older adults groups with 4 or more methylated promoter genes, among the seven age-related genes studied by our group

Discussion

Aging process is associated with several physiologic alterations that occur overtime. These alterations may appear in molecular level, in both genetic and epigenetic pathway depending on genotype, environment and stochastic factors.

DNA methylation pattern of CpG islands is somatic Wa number of specific loci become hypermethylated with aging process [7]. Therefore, genes that have an important role in several cell processes can be susceptible to these alterations.

Sirtuin is a NAD dependent deacetylases family conserved in many organisms, from yeast to humans [8]. SIRT1 has a nuclear location, playing a role in the deacetylation of histone and several non-histone targets, including genes involved in cell cycle, survival, stress response and apoptosis [9].

SIRT1 polymorphisms have been related to healthy aging [10] but, to our knowledge, this is the first study to observe an association between higher promoter methylation in aged group when compared to young group. This fact suggests an epigenetic regulation by DNA methylation and higher SIRT1 expression in young individuals, probably decreasing overtime. SIRT1 activity to induce cell cycle arrest and DNA repair, as well as apoptosis and senescence may reflect the aging cell differences [11-13]. In Alzheimer’s disease, our group observed no differences in DNA methylation levels among elderly and AD groups [14], despite that, we show here differences between healthy young and aged individuals.

IGFBP-3 transcriptional regulation may be mediated by epigenetic modifications, such as methylation [15]. Our results show a higher promoter DNA methylation in aged group when compared to young group; this result is consistent with the CpG island methylation increasing with age [16]. This data support another study that has shown lower DNA methylation in children and young adults [17]. IGFBP-3 is the major binding protein of IGF-1, growth inhibitor and pro-apoptotic factor. The deletion of the studied CpG island appears to be important for decrease mRNA expression in senescent cell [18], therefore, the increased hypermethylation observed might also have an influence in IGBFP-3 expression.

In a previous study by our group in gastric tissue, we have not observed any differences of methylation with age [19]. This finding may be due to tissue-specific epigenetic regulation [20]. Our data may reflect a lower level of IGFBP-3 in serum, therefore its function as endocrine cell growth [21]. Controversially, a study in cellular senescence in human fibroblasts has reported increased mRNA levels of IGBFP-3 [22].

CAV1 is a candidate for tumor suppressor and has been mapped in chromosome 7q31.1, a region commonly deleted in cancer [23]. The gene product, the Caveolin-1 (CAV1) is an integral membrane protein, principal component of caveolae [24]. CAV1 interacts with signaling molecules via membrane-proximal domain, and has been also implicated in regulation of activities and quantitation of cross-talk between distinct signaling cascades [25].

Methylation of the CAV1 gene promoter has been described in different types of cancer, such as prostate [26], breast [23], colorectal [27]. The role of CAV1 in aging has been studied in the sense of response to growth factors, such as epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) [24,25]. An elevated expression of CAV1 has been associated with senescent cells and the responsiveness of these cells for growth factors and re-enter cell cycle has been achieved with lowering caveolin levels [24]. Here we relate no differences of methylation status between young and aged individuals. However, we may speculate that the related change in expression of CAV1 described by Cho et al. [24] may not been regulated by DNA methylation, but it can regulated by different epigenetic modifications such as histone methylation or acetylation or microRNA control.

When taken together the DNA methylation analysis of several genes studied by our group in two moments, in the same sample, we confirmed specific promoter methylation increased in older subjects, as reported previously by others [28,29]. Although our sample size is small, our result corroborates a genome-wide DNA methylation in a large cohort finding that 80% of age-related CpGs at island sites were increasingly-methylated with age [30].

The newly described age-associated methylated CpG sites contribute to recent data in the literature, trying to identify them, to better comprehension of the role of epigenetic variation in the aging process. Moreover, the differential methylation status in these age-related genes might affect the mRNA and protein expression in peripheral tissue of older individuals.

Acknowledgments

This work was supported by National Council for Scientific and Technological Development (CNPq), Foundation for Research Support of the State of São Paulo (FAPESP) and Coordination of Improvement of Higher Education Personnel (CAPES). Burbano RR and Smith MAC have grant research by CNPq. Gigek CO and Leal MF has fellowships granted by FAPESP.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Article Usage

  • Total views: 11662
  • [From(publication date):
    September-2014 - Jun 29, 2017]
  • Breakdown by view type
  • HTML page views : 7887
  • PDF downloads :3775
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords