alexa
Reach Us +441730450007
Small Ubiquitin-related Modifier (SUMO)3 and (SUMO)4 Gene Polymorphisms in Parkinson’s Disease
ISSN: 2329-6895

Journal of Neurological Disorders
Open Access

Our Group organises 3000+ Global Conferenceseries Events every year across USA, Europe & Asia with support from 1000 more scientific Societies and Publishes 700+ Open Access Journals which contains over 50000 eminent personalities, reputed scientists as editorial board members.

Open Access Journals gaining more Readers and Citations
700 Journals and 15,000,000 Readers Each Journal is getting 25,000+ Readers

This Readership is 10 times more when compared to other Subscription Journals (Source: Google Analytics)
All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.
  • Research Article   
  • J Neurol Disord, Vol 7(2)
  • DOI: 10.4172/2329-6895.1000407

Small Ubiquitin-related Modifier (SUMO)3 and (SUMO)4 Gene Polymorphisms in Parkinson’s Disease

Kucukali CI1*, Salman B2, Yuceer H1, Ulusoy C1, Abaci N2, Ekmekci SS2, Tuzun E1, Bilgic B3 and Hanagasi HA3
1Department of Neuroscience, Aziz Sancar Institute of Experimental Medicine, Istanbul University, Istanbul, Turkey
2Department of Genetics, Aziz Sancar Institute of Experimental Medicine, Istanbul University, Istanbul, Turkey
3Department of Neurology, Faculty of Medicine, Istanbul University, Istanbul, Turkey
*Corresponding Author: Kucukali CI, Department of Neuroscience, Aziz Sancar Institute of Experimental Medicine, Istanbul University, Istanbul, Turkey, Tel: +905323355533, Email: [email protected]

Received Date: Mar 21, 2019 / Accepted Date: Jun 04, 2019 / Published Date: Jun 20, 2019

Abstract

Objective: The ubiquitin/proteosome system is one of the main axes of the pathogenesis of Parkinson’s disease (PD). Small ubiquitin-related modifier (SUMO) proteins are involved in many biochemical events including regulation of transcriptional activity, modulation of signal transduction pathways, and response to cellular stress indicating a role for SUMO in the ubiquitin/proteosome system. In this study, our aim was to examine the prevalence of SUMO gene variants and their clinical associations in PD.

Methods: Fifty-four consecutively recruited PD patients and 74 age-gender matched healthy controls were included. SUMO1, 2, 3 and 4 genes were screened by a next generation sequencing method using blood samples of participants. Single nucleotide polymorphisms (SNPs) with a significantly altered prevalence were determined by Bonferroni correction.

Results: Two SNPs in the SUMO4 gene rs237025 and rs237024 and two SNPs in the SUMO3 gene rs180313 and rs235293 were found to have altered prevalence in PD. Although there was no association among these SNPs and clinical features of the patients, an increased family history of cancer was found in patients with SUMO3 gene variants.

Conclusion: Several SUMO SNPs were identified for the first time in PD patients suggesting that SUMO is involved in the pathophysiology of the disease. rs237025 has also been associated with diabetes mellitus indicating a pathogenic mechanism for SUMO that is shared with other degenerative disorders.

Keywords: Parkinson’s disease; SUMO gene; Sumoylation; Ubiquitin; Genetics

Introduction

Parkinson’s disease (PD) is the second most common degenerative disorder of the central nervous system worldwide, with an estimated 7-10 million people affected [1]. Dopaminergic neuron loss and Lewy bodies (LBs) are considered as defining pathological characteristics of PD. The accompaniment of neurofilaments, ubiquitin, and β-amyloid in LBs was demonstrated before the main component α-synuclein was identified in 1997 [2]. Later, immunoreactivity for many other proteins, including parkin, synphilin-1 and the small ubiquitin-related modifier (SUMO) was shown in LBs [3-5].

The mammalian SUMO paralogs SUMO-1 and SUMO-2/SUMO-3, although partially redundant, may fulfill different functions as suggested by various studies on substrate specificity, mono-/polySUMOylation, expression, and oxidative stress [6-9]. It is well known that ubiquitin and SUMO share similarities in respect to tertiary structure and conjugation/deconjugation cycles. SUMO has several different isoforms in mammalians and carries a consensus motif, ubiquitin conjugating enzyme 9 (UBC9) as exclusive SUMO-E2 conjugation enzyme [10]. SUMOylation simultaneously discovered by two groups (Matunis and Mahajan) emerged in recent years as a likely candidate mechanism to regulate a plethora of processes within the cell [11,12]. Surprisingly, research in recent years uncovered the existence of mixing units such as the SUMO-targeted ubiquitin ligases (STUbLs) or E3 ligases with dual functions for SUMO and ubiquitin [13]. Notably, SUMOylation and ubiquitination both regulate α-synuclein degradation and aggregation, a hallmark of PD pathology [14].

Despite its well-established significance in PD pathogenesis, genetic variants of SUMO genes have never been investigated in PD. In this study, our aim was to reveal the presence and prevalence of SUMO gene variants and their associations with clinical features of PD.

Materials and Methods

Patients

In this study, 54 PD (34 male, 20 female) patients and 74 age/gender-matched healthy controls (37 male, 37 female) were included. The diagnosis of the patients was based on clinical PD criteria formulated by the Brain Bank of the United Kingdom PD Association [15]. The study was approved by the Institutional Review Board and signed consent was obtained from all participants. Patients with pyramidal or cerebellar system findings, dyspraxia, autonomic dysfunction, and history of head trauma, encephalitis and exposure to toxic substances were excluded. Also, patients with Parkinson plus syndromes, vascular parkinsonism were not included. Age and gender-matched healthy controls without any known systemic, neurological or psychiatric illness were recruited. In the PD group, severity and clinical course of the disease were assessed by Hoehn-Yahr (H&Y) scale and Unified Parkinson’s Disease Rating Scale (UPDRS) [16-18]. All cases were taken on a standard structured interview and neurological examination was performed.

Next generation sequencing

128 human genomic DNA samples were sequenced by next generation sequencing method. Exomes regions of SUMO1, SUMO2, SUMO3, SUMO4 genes were sequenced.

DNA was isolated from blood samples by Invitrogen DNA isolation kit (Carlsbad, CA, USA) and stored at -80°C. In PCR operations, amplification was conducted using a total volume of 50 μl comprising: 100 ng genomic DNA; a reaction buffer with magnesium chloride and potassium chloride; 1 U Taq polymerase; 2.5 mM deoxynucleotide; and 10 pmol of forward and reverse primers. Using the primers set forth in Table 1, the following cycles were applied: 95°C for 5 min, 35 cycles at 95°C for 30 sec and at 60°C for 40 sec.

Primer Set Forward Primer Series Reverse Primer Series Amplicon Length Amplicon Location
SUMO4 TATGTCTGTGTGTTTTGATCCAGG CCCTACTTAAAGACAGATTGCCCT 1505 bp chr6:149720817-149722321
SUMO3_2 CAATTTTGGTTGTGCCAATCCTTG CCTTGCTGAGAACTTTGTAAAGGG 3768 bp chr21:46226119-46229886
SUMO3_1 GTGAAAATAAGATCTGCCCTCAGC TAGGGTTCCTCTGAGTCACAAATG 1656 bp chr21:46232913-46234568
SUMO2_3 ATCAGCAACAAAGGCAAAATCAGA ATGAAACTTGGAACTTAGTGGAACA 1131 bp chr17:73163481-73164611
SUMO2_2 TAAAGGATCAGAGAGCATCACGTT GTAGCTGTGTCTGAAAAGCAGTAA 2056 bp chr17:73170020-73172075
SUMO2_1 TCCTAAGGGTTTTCACGAGCTATC TGGAAGCCATTTTGATTATGCTCC 2355 bp chr17:73176975-73179329
SUMO1_5 AGAGGGTAATATGAAGGGGACTGA GACAGAATCAGAAGGAAAGACACC 468 bp chr2:203071761-203072228
SUMO1_4 CCAGCCATTAATGTTACCATCACC GCATAGGCTTAGAAACAGGTTTGG 735 bp chr2:203075136-203075870
SUMO1_3 ACTGGTAAGCCATCAAGACAGAAA TGGTGGAAAAATACAGGTTACAAGG 478 bp chr2:203078809-203079286
SUMO1_2 GGCCTCTTCTACCTCTAACAGATG AATGCTGTTTGTATTCTCAGGTGC 343 bp chr2:203084607-203084949
SUMO1_1 GATTAGTCCTCTGGAAGGAGACG GGAGAGAGCAATCTAGGTTGTGAG 784 bp chr2:203102788-203103571

Table 1: Primers used in PCR studies.

Thermal cycler protocol was applied for 8 min at 68°C and 10 min at 72°C. The obtained PCR products were confirmed with gel electrophoresis. All amplicons obtained after PCR were diluted to be at the same concentration and purified using Agencourt Ampure beads kit (Agencourt Bioscience Corporation, MA, USA). The samples were then sequenced using the Illumina MiSeq platform and chemicals, following the manufacturer’s protocols. With an average of 360000 readings per sample, a total of 4019498 2x 150 bp readings and 5.13 Gb data were obtained.

The readings in the target position (Table 2) from the array data obtained after the scrambling were filtered out. The obtained raw sequence data were truncated considering the quality scores (Trimmomatic v0.27). The corrected crude sequence data was aligned to the human genomic reference sequences (GRCh37, GRCh38) (using the Burrows-Wheeler Aligner). Subsequently, a local realignment was performed Genome Analyzer Tool Kit (GATK IndelRealigner v3.3.0) to align the the indel. After merging and alignment, reading count optimization, base quality recalibration was performed by filtering the repetitive readings using the GATK (v3.3.0) application. In the last step, single point variants and indices were determined using GATK (Unified Genotyper).

Location Gene P-value Bonferroni FDR
P-value Correction
Experiment Group Experiment Group (%) Control Group Control Group (%)
chr21:46228165 T>C SUMO3 1.87E-03 0.07 0.04 7 12.96 0 0
chr21:46233230 C>T SUMO3 1.87E-03 0.07 0.04 7 12.96 0 0
chr17:73171791 G>T SUMO2 4.15E-03 0.1 0.05 11 20.37 3 4.05
chr21:46228930 C>T SUMO3 4.32E-03 0.17 0.06 8 14.81 1 1.35
chr21:46233071 A>G SUMO3 6.67E-03 0.26 0.07 9 16.67 2 2.7
chr21:46227798 C>T SUMO3 9.89E-03 0.39 0.08 7 12.96 1 1.35
chr6:149721965 T>C SUMO4 0.02 0.11 0.08 40 74.07 40 54.05
chr6:149721690 G>A SUMO4 0.02 0.16 0.08 42 77.78 44 59.46
chr6:149722189 A>C SUMO4 0.05 0.33 0.11 19 35.19 15 20.27
chr21:46227364 G>A SUMO3 0.05 1 0.31 5 9.26 1 1.35

Table 2: Comparison of Significant Variants in The SUMO Gene Between the Patient and Control Groups.

All candidate variants (small insertions, deletions, single nucleotide changes) obtained as a result of the exon sequencing analysis were first compared to the minor allele frequency (MAF) (MAF ≤ 0.01 variants) using general control databases (ExAC, 1000 Genome) in Table 3. The obtained variants were assessed using Integrative Genomic Viewer (IGV 2.3, Broad Institute) program.

CHR REGION GENE TYPE REFERENCE ALLELE P VALUE BONFERRONI FDR P VALUE CORRECTION SAMPLE # (CASE) TOTAL # (CASE) SAMPLE FREQUENCY (CASE) SAMPLE # (CONTROL) TOTAL # (CONTROL) SAMPLE FREQUENCY (CONTROL) dbSNP / rs NUMBER 1000G MAF
6 149400554 SUMO4 SNV G A 0,025967806 0,233710254 0,058427563 43 54 79,62962963 46 74 62,16216216 237025 0,354 0.354 G
6 149400829 SUMO4 SNV T C 0,025967806 0,233710254 0,058427563 43 54 79,62962963 46 74 62,16216216 237024 0,298 0.298 T
21 44807883 SUMO3 SNV C T 0,034386497 1 0,756402927 8 54 14,81481481 3 74 4,054054054 180313 0,965 0.035 T
21 44809015 SUMO3 SNV C T 0,034386497 1 0,756402927 8 54 14,81481481 3 74 4,054054054 235293 0,973 0.027 T
21 44808250 SUMO3 SNV T C 0,106078076 1 0,794894473 11 54 20,37037037 8 74 10,81081081 7283639 0,93 0.070 C
6 149399822 SUMO4 SNV A G 0,148891461 1 0,223337191 24 54 44,44444444 25 74 33,78378378 34097428 0,804 0.196 G
6 149401053 SUMO4 SNV A C 0,148891461 1 0,223337191 24 54 44,44444444 25 74 33,78378378 9498344 0,804 0.196 G
21 44813315 SUMO3 SNV C T 0,213242759 1 0,794894473 11 54 20,37037037 10 74 13,51351351 2838696 0,933 0.067 T
17 75175696 SUMO2 SNV G A 0,271711759 1 0,65625 7 54 12,96296296 6 74 8,108108108 149700459 0,925 0.052 T
17 75175696 SUMO2 SNV G T 0,275238546 1 0,65625 15 54 27,77777778 16 74 21,62162162 149700459 - -
21 44807449 SUMO3 SNV G A 0,31813023 1 0,794894473 9 54 16,66666667 9 74 12,16216216 73232962 0,944 0.056 A
21 44807688 SUMO3 SNV T C 0,321434473 1 0,794894473 22 54 40,74074074 26 74 35,13513514 9984357 0,237 0.237 C
21 44807957 SUMO3 SNV C A 0,380953577 1 0,794894473 13 54 24,07407407 15 74 20,27027027 2838693 2838693 0.293 A
17 75182038 SUMO2 SNV A G 0,38285644 1 0,656252 2 54 3,703703704 1 74 1,351351351 548029059 0,998 0.002 G
21 44813057 SUMO3 SNV A G 0,403359823 1 0,794894473 18 54 33,33333333 22 74 29,72972973 17217834 0,937 0.063 G
17 75181714 SUMO2 SNV G T 0,42041558 1 0,65625 5 54 9,259259259 5 74 6,756756757 75642533 0,974 0.026 T
17 75167687 SUMO2 SNV C T 0,421875 1 0,65625 1 54 1,851851852 0 74 0 533678937 0,999 <0.01 T
17 75167713 SUMO2 SNV A G 0,421875 1 0,65625 1 54 1,851851852 0 74 0 118066102 0,994 0.006 G
17 75174283 SUMO2 SNV T C 0,421875 1 0,65625 1 54 1,851851852 0 74 0 187263668 0,996 0.004 C
17 75174620 SUMO2 DEL T - 0,421875 1 0,65625 1 54 1,851851852 0 74 0 - - -
17 75174993^75174994 SUMO2 INS - T 0,421875 1 0,65625 1 54 1,851851852 0 74 0 - - -
17 75175161 SUMO2 SNV T A 0,421875 1 0,65625 1 54 1,851851852 0 74 0 - - -
17 75175249 SUMO2 SNV C T 0,421875 1 0,65625 1 54 1,851851852 0 74 0 - - -
17 75175651 SUMO2 SNV A G 0,421875 1 0,65625 1 54 1,851851852 0 74 0 - - -
17 75175860 SUMO2 SNV T C 0,421875 1 0,65625 1 54 1,851851852 0 74 0 - - -
17 75175956 SUMO2 SNV T A 0,421875 1 0,65625 1 54 1,851851852 0 74 0 - - -
17 75181348^75181349 SUMO2 MNV GC AA 0,421875 1 0,65625 1 54 1,851851852 0 74 0 - - -
17 75181878 SUMO2 SNV G A 0,421875 1 0,65625 1 54 1,851851852 0 74 0 - - -
17 75181977^75181978 SUMO2 INS - G 0,421875 1 0,65625 1 54 1,851851852 0 74 0 567293884 0,006 0.006 G
17 75182888 SUMO2 SNV G C 0,421875 1 0,65625 1 54 1,851851852 0 74 0 563782248 0,999 <0.001 C
21 44805481 SUMO3 SNV C T 0,421875 1 0,794894473 1 54 1,851851852 0 74 0 2838692 0,867 0.133 T
21 44806880 SUMO3 SNV G A 0,421875 1 0,794894473 1 54 1,851851852 0 74 0 533039230 0,997 0.003 A
21 44806939 SUMO3 SNV G C 0,421875 1 0,794894473 1 54 1,851851852 0 74 0 0 0 0
21 44807181 SUMO3 SNV C G 0,421875 1 0,794894473 1 54 1,851851852 0 74 0 146097096 0,996 0.004 G
21 44807507 SUMO3 SNV G A 0,421875 1 0,794894473 1 54 1,851851852 0 74 0      
21 44809654 SUMO3 SNV C T 0,421875 1 0,794894473 1 54 1,851851852 0 74 0 568371060 0,995 0.005 T
21 44813234 SUMO3 SNV C T 0,421875 1 0,794894473 1 54 1,851851852 0 74 0 - - -
21 44813674 SUMO3 SNV A T 0,421875 1 0,794894473 1 54 1,851851852 0 74 0 - - -
21 44813702 SUMO3 SNV A G 0,421875 1 0,794894473 1 54 1,851851852 0 74 0 - - -
21 44813967 SUMO3 SNV G A 0,421875 1 0,794894473 1 54 1,851851852 0 74 0 375002240 0,999 0.003 A
21 44814454 SUMO3 SNV T C 0,421875 1 0,794894473 1 54 1,851851852 0 74 0 - - -
2 202238678 SUMO1 SNV G A 0,443984885 1 0,794894473 38 54 70,37037037 50 74 67,56756757 3754931 0,627 0.063 T
21 44808833 SUMO3 SNV C T 0,444624014 1 0,794894473 19 54 35,18518519 24 74 32,43243243 873301 0,937 0.063 T

Table 3: The genetic characteristics and statistical results of the identified variants.

Statistical analysis

Prevalences of SUMO gene variants were compared among patient and healthy control groups by Chi-square test and Bonferroni test. Chi-square, T-test and Mann-Whitney U statistical tests were used for the comparison of clinical and demographic parameters among study groups. p<0.05 was considered statistically significant.

Results

SUMO gene variants

As a result of the in-depth sequencing, 48 SNPs were detected in the SUMO1, SUMO2, SUMO3 and SUMO4 genes. Significant (p<0.05) SNPs determined by comparing patients and controls were rs237025 and rs237024 in the SUMO4 gene and rs180313 and rs235293 in the SUMO3 gene, respectively. None of the p values remained significant after Bonferroni correction in Table 3. According to these results, 42 of the 54 PD patients were found to display rs237025 and rs237024 variants of the SUMO4 gene. On the other hand, in 8 patients, rs180313 and rs235293 variants were determined in the SUMO3 gene. The SNP and p values in the control group are shown in Table 3.

Comparison of PD patients with and without SUMO variants

PD patients with and without SNPs SUMO genes were compared in terms of clinical and demographic characteristics. The parameters considered in the comparison are summarized in Tables 4A and 4B. There were no statistically significant differences between the groups in terms of age, sex, age at onset, duration of disease, Hoehn-Yahr scores, dementia, depression, and family history of PD. PD patients with rs180313 and rs235293 variants but not rs237025 and rs237024 variants had a significantly higher prevalence of family history of cancer (Table 4B).

  PD patients with rs237025 and rs237024 variants (42) PD patients without rs237025 and rs237024 variants (12) p-value
Age 62.8 ± 11.8 62.8 ± 17.2 0.497*
Gender (M/F) 27/15 7/5 0.970**
Age of disease onset 52.6 ± 12.9 54.6 ± 15.3 0.347*
Duration of disease 10.1 ± 6.2 8.2 ± 5.5 0.150*
Hoehn-Yahr score 1.8 ± 0.6 2.1 ± 0.7 0.094†
UPDRS toral-score 64.5 ± 66.2 66.2 ± 32.1 0.443†
History of PD in the family 6 3 0.660**
History of cancer in the family 7 5 0.148**
History of DM type II in the family 9 5 0.299**
Postural instability†† 1 1 0.923**
Dementia 3 1 0.889**
Depression 5 2 0.664**

Table 4A: Distribution of demographic and clinical features of Parkinson's disease (PD) patients according to the presence of rs237025 and rs237024 variants in the SUMO4 gene.

  PD patients with rs180313 and rs235293 variants (8) PD patients without rs180313 and rs235293 variants (46) p-value
Age 62.0 ± 10.3 62.9 ± 13.5 0.415*
Gender (M/F) 5/3 29/17 0.976**
Age of disease onset 55.0 ± 9.9 52.7 ± 13.9 0.294*
Duration of disease 7.0 ± 4.9 10.2 ± 6.2 0.165*
Hoehn-Yahr score 1.8 ± 0.5 1.9 ± 0.7 0.273†
UPDRS toral -score 50.4 ± 31.0 67.6 ± 46.2 0.101†
History of PD in the family 2 7 0.864**
History of cancer in the family 6 6 0.001**
History of DM type II in the family 4 10 0.212**
Postural instability†† 0 2 0.164**
Dementia 1 3 0.551**
Depression 1 6 0.966**

Table 4B: Distribution of demographic and clinical features of Parkinson's disease (PD) patients according to the presence of rs180313 and rs235293 variants in the SUMO3 gene.

Discussion

PD is a neurodegenerative disease that primarily affects the substantia nigra, and accounts for 80% of all parkinsonism cases. Epidemiological studies have shown that about 1% of the population over 65 years old suffer from this disease. At least 60-80% of dopaminergic cells of substantia nigra need to be lost in order for the findings of PD to appear [19]. Precise mechanisms leading to nigral degeneration, responsible for the clinical manifestations of the disease are as yet not entirely clear and genes associated with increased PD susceptibility still continue to be characterized. Hereditary predisposition, environmental factors, mitochondrial dysfunction and ubiquitin cycling are crucially involved in this process [20].

In this context, significance of SUMO and sumoylation in neurodegenerative disorders has been recently scrutinized. Although PD cases are mostly sporadic, several genes have also been associated with familial types of disease. α-synuclein, DJ-1 and parkin are three of these genes and are target proteins for SUMO, indicating the role of this molecule in the molecular mechanisms of PD pathogenesis [21,22]. SUMO proteins bind to large number of cellular targets. It modulates protein-protein and protein-DNA interactions, modifies intracellular localizations of proteins and protects cells from ubiquitin-induced degradation [11,12]. Sumoylation is functionally a more varied modifier than ubiquitination and unlike ubiquitination, proteins do not directly target the proteasome. Instead, sumoylation blocks proteosomal degradation by competing with ubiquitination for a common lysine residue and substrate samples are used for this process [5,23]. SUMO and ubiquitin also have a variety of functional and structural properties that play a role in the regulation and coordination of different stages of DNA damage recognition and repair, regulation of replication and replication stress, protection of genomic stability, and various other cellular events [14,23].

In our study, two significant SNPs were determined in the SUMO4 gene (rs237025 and rs237024) and two additional SNPs were found in the SUMO3 gene (rs180313 and rs235293). To our knowledge, three of the four significant SNPs have not been previously reported and rs237025 has only been linked to diabetes mellitus, another degenerative disease. None of the identified SNPs appear to be associated with severity or clinical features. Nevertheless, increased prevalence of these SNPs in PD patients might be due to their involvement in the pathogenesis of PD. The rs237025 variant of SUMO4 causes a missense mutation leading methionine to convert to valine. SUMO4 is known to contribute to enhanced cell survival through suppression of inflammation. Moreover, the rs237025 variant of SUMO4 has been suggested to promote intracellular inflammation pathways through NF-κB activation and thus negatively influence cell survival [24]. It is well known that different degenerative disorders might share common molecular mechanisms and due to its multifunctionality, SUMO might be one of these common mechanism factors.

The rs237024 SNP is in the 3’UTR region of the SUMO4 gene and rs180313 and rs235293 genes are found in the intronic area of the SUMO3 gene. Nevertheless, it is well known that mutations and SNPs occurring in non-coding regions may have significant molecular and clinical consequences [25]. Exact mechanisms by which these SNPs contribute to PD pathogenesis need to be further studied.

A notable finding in our study was the association between SUMO3 rs180313 and rs235293 variants and family history of cancer. To our knowledge, SNPs of SUMO genes have not been associated with increased cancer risk. However, SNPs of SUMO-conjugating enzyme UBC9 and E3 SUMO-protein ligase protein inhibitor of activated STAT 3 (PIAS3) genes have been shown to contribute to increased risk of breast cancer [26]. Nevertheless, since only a limited number of patients displayed these variants, our results need to be confirmed by future studies.

Conclusion

In conclusion, in this study, we have determined certain SNPs in SUMO genes for the first time in PD patients, have found a link between SUMO4 and a neurological disease for the first time and thus provided further evidence for involvement of sumoylation in the pathophysiology of the disease. The mechanisms by which identified SUMO3 and SUMO4 SNPs contribute to the pathogenesis of PD need to be further studied by functional experiments. Our results also indicate that sumoylation molecules may be potential targets for novel therapeutics of PD. This notion requires a better understanding of biochemical activators of SUMO genes, which have been vastly understudied.

Acknowledgements

We are grateful to the patients and families for their participation and to the anonymous reviewers for their valuable advice.

Funding

The present work was supported by the Research Fund of Istanbul University.

Compliance with Ethical Standards

All procedures performed in studies involving human participants were in accordance with the ethical standards of Istanbul University, Istanbul Faculty of Medicine, Clinical Research Ethical Committee (Project Number 2011/672-528) and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.

References

Citation: Kucukali CI, Salman B, Yuceer H, Ulusoy C, Abaci N, et al. (2019) Small Ubiquitin-related Modifier (SUMO)3 and (SUMO)4 Gene Polymorphisms in Parkinson’s Disease. J Neurol Disord 7: 407. DOI: 10.4172/2329-6895.1000407

Copyright: © 2019 Kucukali CI, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Select your language of interest to view the total content in your interested language

Post Your Comment Citation
Share This Article
Relevant Topics
Recommended Conferences
Article Usage
  • Total views: 550
  • [From(publication date): 0-0 - Nov 17, 2019]
  • Breakdown by view type
  • HTML page views: 507
  • PDF downloads: 43
Top