alexa Stimulated And Non-Stimulated Salivary Flows Should Be Tested For The Presence Of HCV RNA In Saliva Samples From Patients With Chronic Hepatitis C | Open Access Journals
ISSN: 2161-1122
Dentistry
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Stimulated And Non-Stimulated Salivary Flows Should Be Tested For The Presence Of HCV RNA In Saliva Samples From Patients With Chronic Hepatitis C

Grossmann SMC1,4*, De Oliveira GC2, Teixeira R3 and Vieira do Carmo MA1

1Department of Oral Surgery and Pathology, School of Dentistry, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil

2René Rachou Fiocruz Research Centre, Belo Horizonte, Minas Gerais, Brazil

3Department of Medical Clinic, School of Medicine, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil

4Department of Oral Diagnosis, School of Dentistry, Universidade Vale do Rio Verde, Belo Horizonte, Brazil

*Corresponding Author:
Soraya de Mattos Camargo Grossmann
Universidade Vale do Rio Verde
Faculdade de Odontologia, Rua Gentios, 1420 – Luxemburgo
Belo Horizonte - CEP: 37410-000, Minas Gerais, Brazil
Tel: + 55-31-33441366
E-mail: [email protected]

Received date: February 26, 2014; Accepted date: April 18, 2014; Published date: April 20, 2014

Citation: Grossmann SMC, De Oliveira GC, Teixeira R, Vieira do Carmo MA (2014) Stimulated and Non-Stimulated Salivary Flows Should be Tested for the Presence of HCV RNA in Saliva Samples from Patients with Chronic Hepatitis C. Dentistry 4:232. doi: 10.4172/2161-1122.1000232

Copyright: © 2014 Grossmann SMC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Dentistry

Abstract

Objective: In most of the studies which analyzed the presence of HCV RNA in saliva from patients with chronic hepatitis C only stimulated saliva samples have been used for viral detection. Thus, this study compared the prevalence of HCV RNA in non-stimulated and stimulated salivary flows in patients with chronic hepatitis C.
Design: Saliva samples of non-stimulated and stimulated salivary flows from 24 patients were collected, and the HCV RNA was investigated by RT-nested PCR. Data regarding age, gender, risk factors for HCV infection, xerostomia and hyposalivation were also analyzed.
Results: The HCV RNA could be detected in 11 (45.8%) non stimulated and in 14 (58.3%) stimulated saliva samples, without statistical significance (p=0.472). However, in 18 (75.0%) patients it was possible to detect the presence of the HCV RNA at least in one of the saliva samples. Six (25.0%) patients complained of xerostomia and nine (37.5%) presented hyposalivation, but in only 3 (12.5%) patients, these conditions could be observed, simultaneously. No significant correlation between the presence of HCV RNA in saliva and age, gender, risk factors for HCV infection, xerostomia and hyposalivation could be identified.
Conclusion: Both stimulated and non-stimulated saliva samples must be investigated for the presence of HCV RNA in patients with chronic hepatitis C, to avoid underestimated prevalence of HCV in this group of patients.

Keywords

HCV RNA; Saliva; Chronic Hepatitis C; HCV

Introduction

Hepatitis C Virus (HCV) infection is a major cause of chronic liver disease and liver-related morbidity and mortality worldwide and it is the most prevalent reason for liver transplants in Europe and in the USA [1].

Up to 74% of the HCV-infected patients may develop at least one Extra Hepatic Manifestation (EHM) during the course of the infection, such as salivary gland disorders, being the HCV considered as a sialotropic virus [2-6]. The reported prevalence of the HCV RNA in saliva ranges from 0 to 100% [7,8]. In a recent study conducted with Brazilian patients, Grossmann et al. [9] detected the HCV RNA in 39.0% of the non-stimulated saliva samples in patients with serum positive HCV RNA. These discrepancies may be due to the heterogeneity of the study design, population studied as well as different methodologies used as saliva sampling methods.

Xerostomia in patients with chronic Hepatitis C ranges from 10 to 20% [2,10] and its association with an objective evidence of salivary gland dysfunction like hyposalivation has been described in previous literature [11,12]. It has been suggested that whole saliva could be used as a screening test for identifying a suspected exocrine hypofunction and an abnormality in the salivary gland, such as the Sjögren Syndrome[13].

As the prevalence of HCV in saliva samples shows important differences among the studies, and most of them analyze only stimulated salivary flows [11,14], the aim of this study was to compare the prevalence of HCV RNA in saliva samples between non stimulated and stimulated salivary flows in a group of patients with chronic Hepatitis C. The possible association with xerostomia and presence of hyposalivation were also evaluated.

Patients and Methods

Patients

A cross-sectional survey was carried out on 24 HCV patients with confirmed diagnosis of chronic Hepatitis C (anti-HCV positive, Elisa III, HCV RNA qualitative test positive) admitted to the Viral Hepatitis Reference Center of the Alfa Institute of Gastroenterology at the Clinical Hospital of Universidade Federal de Minas Gerais (AHEV/IAG-HC/UFMG), Belo Horizonte, Brazil. The study was approved by the UFMG Ethical Committee for Surveys, and all volunteers signed an informed consent form. All patients were HIV (human immunodeficiency virus) and HBV (Hepatitis B virus) negative and had no other concomitant liver diseases. Patients receiving antiviral treatment for Hepatitis C were also excluded from the study. Demographical data as well as risk factors for the acquisition of the infection were assessed from medical records. Intra-oral examination was performed on all patients.

Xerostomia

Patients were inquired in relation to symptom of dry mouth (xerostomia). If present, xerostomia was classified as mild, moderate, or severe, as previously described [4] and the patients received treatment with artificial saliva gel (Oral Balance- Biotene®) to relieve their symptom.

Saliva samples

Patients refrained from oral hygiene, eating, drinking, and smoking 60 min before non-stimulated (NSSF) and stimulated (SSF) salivary collection in sterile 50 mL Falcon tubes. The entire NSSF produced during three minutes was collected. Rates = 0.1 ml/min was considered hyposalivation, as previously established [15]. Subsequently, patients were asked to chew a sterile rubber cylinder for three minutes before spitting saliva to measure SSF. Rates of = 0.7 ml/min were considered as hyposalivation [15]. All saliva samples were immediately stored at –80°C.

Detection of HCV RNA in the saliva

HCV RNA was extracted from 200 µL of undiluted saliva using a commercial viral RNA isolation kit (Qiaamp, Qiagem, Hildem Germany), according to manufacturer’s instructions. Nested reverse transcription-polymerase chain reaction (RT-PCR) was performed, by amplification of a 251 bp fragment from the 5’ UTR region of HCV with a minor adaptation described by Oliveira et al. [16]. Briefly, a single-strand cDNA was synthesized from 18 µL of the RNA sample at 42°C for 50 minutes with 200 U of reverse transcriptase (Superscript II, GIBCO, BRL, Rockville, MD, USA) in 30 µL of a manufacturer supplied buffer containing 10 pmole of primer 209 (ATACTCGAGGTGCACGGGTCTACGAGACCT), 10 mM of each dNTP, and 10 nM of dithiothreitol. For the first-round of PCR, 2 µL of cDNA were added to a mixture containing 2 µl of 10x of the supplied PCR buffer, 5 mM of MgCl2, 10 mM of each dNTP, 10 pmole of primers 939 (CTGTGAGGAACTACTGTCTT) and 209, and 5U of Taq DNA polymerase (GIBCO/ BRL). The mixture was cycled 30x in a thermocycler (Perkin Elmer Gene Amp PCR System 2400) at 95°C for 5 minutes, 95°C for 1 minute, 50°C for 1 minute, 72°C for 1 minute, and again at 72°C for 1 minute. The second-round of PCR (nested) was carried out as above, using primers 940 (TTCACGCAGAAAGGGTCTAG) and 211 (CACTCTCGGAGCACCCTATCAGGCAGT) as well as 1.5U of Taq polymerase. The PCR products were electrophoresed in a 6% polyacrylamide gel, using a vertical electrophoresis apparatus (Model S2 Life Technologies Inc.) and stained with silver nitrate. The banding pattern was visualized and analyzed as described by McOmish [17]. A known HCV RNA positive saliva sample was used as a positive control and, to a negative control, viral RNA was omitted.

Statistical analysis

Chi-square and Fisher’s tests were used for univariate analysis. p value = 0.05 was considered significant.

Results

The group studied consisted of 13 (54.2%) females and 11 (45.8%) males, with a mean age of 52.4 years and median of 52 years (range 29-73 years of age). Main sources of infection included blood transfusions in 10 (41.7%) cases and intravenous drug use in 4 (16.7%) cases. Risk factors could not be identified in 4 (16.7%) patients (Table 1).

  HCV RNA in non-stimulated salivary flow HCV RNA in stimulated salivary flow
Positive
n (%)
Negative
n (%)
  p Positive
n (%)
Negative
n (%)
p
Gender     0.115     0.184
Female 4 (36.4) 9 (69.2)   6 (42.9) 7 (70.0)  
Male 7 (63.6) 4 (30.8)   8 (57.1) 3 (30.0)  
Risk Factors
Blood transfusion
i.v. drug use
percutaneous exposure
others
unknown
4 (36,4)
3 (27,3)
2 (18,2)
0 (0,0)
2 (18,2)
6 (46,2)
1 (7,7)
0 (0,0)
4 (30,8)
2 (15,4)
0.121* 5 (35.7)
3 (21.4)
1 (7.1)
4 (28.6)
1 (7.1)
5 (50.0)
1 (10.0)
1 (10.0)
0 (0.0)
3 (30.0)
0.241*      

Table 1: Prevalence of HCV RNA in saliva, according to gender and risk factors.

HCV RNA was detected in non-stimulated saliva samples of 11 (45.8%) patients (4 women and 7 men) and in stimulated saliva samples of 14 (58.3%) patients (6 women and 8 men), with no statistical difference (p=0.472) (Table 2). In only 7 (29.2%) patients the HCV RNA could be detected in both, NSSF and SSF, simultaneously. However, in 18 (75.0%) patients it was possible to detect the presence of the HCV RNA at least in one of the saliva samples.

HCV RNA in stimulated salivary flow HCV RNA in non-stimulated salivary flow
Positive
n (%)
  Negative
n (%)
TOTAL n (%) p p
Positive
n (%)
7 (63.6) 7 (53.8) 14 (100.0) 0.472
Negative
n (%)
4 (45.8) 6 (46.2) 10 (100.0)
TOTAL n (%) 11 (100.0) 13 (100.0) 24 (100.0)

Table 2: Correlation between the prevalence of HCV RNA in stimulated and non-stimulated salivary flows.

Six (25.0%) patients complained of oral dryness (xerostomia) which was mild in 4 (16.7%) patients, and moderate in 2 (8.3%) cases. Considering the entire sample, hyposalivation could be observed in 9 (37.5%) cases of non-stimulated salivary flow and in 8 (33.3%) cases of stimulated salivary flow. However, in only 3 (12.5%) cases the xerostomia and hyposalivation could be observed, simultaneously (Table 3).

Xerostomia Non stimulated salivary flow Stimulated salivary flow
Normal
n (%)
Hyposalivation
n (%)
  p Normal
n (%)
Hyposalivation
n (%)
p
Present
Absent
5 (33.3)
10 (66.7)
1 (11.1)
8 (88.9)
  0.237 4 (25.0)
12(75.0)
2 (25.0)
6 (75.0)
  0.68*
TOTAL n (%) 15 (100.0) 9 (100.0)   16 (100.0) 8 (100.0)  

Table 3: Correlation between the prevalence of xerostomia and hyposalivation and salivary flows

Among the patients with xerostomia and hyposalivation, in both different flows, the HCV could be detected more frequently in saliva sample from non-stimulated salivary flow (6 cases) (Table 4).

  HCV RNA in non-stimulated salivary flow HCV RNA in stimulated salivary flow
  Positive
n (%)
Negative
n (%)
p Positive
n (%)
Negative
n (%)
p
Xerostomia
Present
Absent
3 (27.3)
8 (72.7)
3 (23.1)
10 (76.9)
0.589 3 (21.4)
11 (78.6)
3 (30.0)
7 (70.0)
0.494  
Non Stimulated Salivary Flow
Normal
Hyposalivation
8 (72.7)
3 (27.3)
7 (53.8)
6 (46.2)
0.300 8 (57.1)
6 (42.9)
7 (70.0)
3 (30.0)
0.418  
Stimulated Salivary Flow
Normal
Hyposalivation
7 (63.6)
4 (36.4)
9 (69.2)
4 (30.8)
0.555 10 (71.4)
4 (28.6)
6 (60.0)
4 (40.0)
0.438  
TOTAL 11 (45.8) 13 (54.2)   14 (58.3) 10 (41.7)  

Table 4: Prevalence of HCV RNA in relation to the presence of xerostomia and hyposalivation in stimulated and non-stimulated salivary flows.

Oral mucosal alterations, including variations of normality and mucosal lesions were observed in 20 (83.3%) patients. The most common alterations were traumatic lesions in 8 (33.4%) cases, followed by Fordyce’s spots in 6 (25.0%) cases, and candidiasis in 4 (16.7%) cases.

Discussion

As Hepatitis C is often asymptomatic or shows no specific manifestation in the acute phase, the WHO estimates that there are millions of undiagnosed HCV-infected people, constituting an important link in the chain of HCV transmission [18]. Thus, the recognition of extra Hepatic manifestations of this infection is considered of great importance regarding the establishment of an early diagnosis.

As expected, the main source of transmission of HCV in the present study was blood transfusion (41.7%), which is in accordance with that reported in the literature [1]. Besides, in 4 patients (16.7%), the source of infection was unknown, in accordance with our previous study [9,19,20].

Considering the reported sialotropism of HCV, with different findings, and taking into account that most of the studies used only stimulated salivary flow, the present study aimed to compare the prevalence of HCV RNA in saliva samples from non-stimulated and stimulated salivary flows. Our results showed the presence of HCV RNA in non-stimulated and stimulated saliva samples in 11 patients (45.8%) and in 14 patients (58.3%), respectively, with no statistically significant difference (p=0.472). These findings suggest that both non-stimulated and stimulated saliva samples are equally suitable for the investigation of the presence of salivary HCV RNA. In only 7 (29.2%) patients the HCV RNA could be detected in both, NSSF and SSF, simultaneously. However, a very higher prevalence could be observed in 18 (75.0%) patients in whom it was possible to detect the presence of the HCV RNA at least in one of the saliva samples. We consider this as an important finding that points toward the necessity of investigation the presence of HCV RNA in both salivary flows, taking into account that the mechanism of viral shedding is not well-understood. It is also necessary to emphasize that a more representative sample to determinate the real prevalence of HCV RNA in saliva is warranted.

Some authors reported that there is no correlation between the presence of anti-HCV antibodies in saliva and the detection of HCV RNA in saliva and salivary glands in patients with chronic Hepatitis C [21]. However, others suggested that the salivary HCV viral load is significantly lower than the viral load in the serum16, and this could explain the controversial results that investigate the HCV in saliva in patients with chronic Hepatitis C.

No significant correlations were found between the presence of HCV RNA in non-stimulated or stimulated saliva samples and age, gender, risk factors, xerostomia, or hyposativation in accordance with previous study [9]. We consider that the xerostomia and hyposalivation in Hepatitis C patients is not association with direct detection of HCV in saliva. We results suggest that an indirect effect as more inflammatory cells in salivary gland (PATRICIA) could be responsible for xerostomia and hyposalivation in this group of patients.

In the present study, six (25.0%) patients complained of oral dryness (xerostomia) and hyposalivation could be identified in 9 (37.5%) patiens, with no statistical significance. Dry mouth (xerostomia) has been reported in 0 to 35% patients with chronic Hepatitis C [2,5,11,14]. Some authors have the HCV as a virus with a triple tropism (Hepatotropism, lymphotropism, and sialotropism), which could explain the xerostomia in these patients [14]. In addition, the reduced salivary flow rate (hyposalivation) in Hepatitis C patients could be due to infiltration of the salivary gland by the virus [12] or to a possible virus induced immune mechanism [22,23]. However, in only 3 cases (12.5%) xerostomia and hyposalivation were observed, simultaneosly. Moreover, in 9 of 10 patients without xerostomia, the hyposalivation was also detected. In these patients could not to demonstrate the association between xerostomia and use of medication. As xerostomia is a subject symptom and hyposalivation is an objective find, thus we consider that this association should be more investigate. Despite the small sample, our results agree with those obtained by Henderson et al. [11] and Ferreiro et al. [14], who found a weak association between xerostomia and hyposalivation. Further research to elucidate this point is needed.

Oral mucosal alterations were observed in almost all evaluated patients with chronic Hepatitis C (83.3%) as in our previous study [20]. Due to the high global prevalence of chronic Hepatitis C, and the potential association between oral lichen planus and chronic Hepatitis C [19], we consider important periodic oral examination in order to promote the suitable and full health assistance to these patients.

Although in stimulated and non-stimulated salivary flows it is possible the detection of HCV RNA, and regardless the small sample, our findings strongly suggest that the investigation should be performed in both samples, to avoid bias regarding the real prevalence of this virus in saliva of patients with chronic Hepatitis C. Moreover, the detection of HCV RNA in saliva cannot determine definitively a direct effect of this virus in presence of xerostomia and hyposalivation in Hepatitis C patients. Thus, investigations that try elucidating the possible sialotropism of HCV are necessary.

Acknowledgements

This study was supported by grants from CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior), FAPEMIG (Fundação de Amparo à Pesquisa do Estado de Minas Gerais) and CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico - National Counsel of Technological and Scientific Development). Dra. Teixeira R and Dr. Oliveira GO are research fellows of CNPq.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

  • 39th South American Dental Congress
    Dec 4-6,2017 Sao Paulo,Brazil

Article Usage

  • Total views: 11589
  • [From(publication date):
    May-2014 - Nov 20, 2017]
  • Breakdown by view type
  • HTML page views : 7820
  • PDF downloads : 3769
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords