alexa Tetracycline Resistant Genes in E. coli Isolated from UTI and Diarrhea Patients in Zaria, Nigeria | Open Access Journals
ISSN: 2327-5073
Clinical Microbiology: Open Access
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Tetracycline Resistant Genes in E. coli Isolated from UTI and Diarrhea Patients in Zaria, Nigeria

Igwe JC1*, Musa A2, Olayinka BO3, Ehnimidu JO3 and Onaolapo JA3

1Department of Medical Biotechnology, National Biotechnology Development Agency, Abuja, Nigeria

2Department of Water Sanitation and Hygiene, Dutse Local Government, Jigawa State, Nigeria

3Department of Pharmaceutics and Pharmaceutical Microbiology, Ahmadu Bello University, Zaria, Nigeria

*Corresponding Author:
Igwe JC
Department of Medical Biotechnology
National Biotechnology Development Agency
Abuja, Nigeria
Tel: +234-8069430222
E-mail: [email protected]

Received Date: October 07, 2015; Accepted Date: December 23, 2015; Published Date: December 30, 2015

Citation: Igwe JC, Musa A, Olayinka BO, Ehnimidu JO, Onaolapo JA (2015) Tetracycline Resistant Genes in E. coli Isolated from UTI and Diarrhea Patients in Zaria, Nigeria. Clin Microbiol 4:225. doi: 10.4172/2327-5073.1000225

Copyright: © Igwe JC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Clinical Microbiology: Open Access

Abstract

Tetracycline (TC) is one of the widely used antibiotics for the treatment of infections with significant therapeutic effect due to its broad spectrum. But due to the emergence of high percentages of tetracycline resistance and the recent reoccurrence of multidrug resistance isolates in clinical settings, its use in hospitals have drastically reduced. This study evaluates the percentage of TC resistant in clinical isolates of E. coli from UTI and diarrhea patients in Zaria, Nigeria. Out of the 86 E. coli isolates collected from 4 hospitals for the period of 6 months (April-September, 2014), 68.6% (59) were observed to be resistant to TC using both disc diffusion and MIC (range of ≥ 4 μg/ml) methods. The antibiotic susceptibility profile of the isolates showed that the isolates had varied antibiotic resistant profile to the 14 antibiotics tested. Significant percentage (35.6% (21)) of the isolates also exhibited simultaneous resistance to Ciprofloxacin, Gentamicin and Amoxicillin. The isolates were also observed to have high MARI, and there molecular analysis showed that 95% (20) of the MDR isolates had TetA gene while 90.5% (19) had TetB gene. Our results showed that there is a correlation between phenotypic TC resistance and genomic TetA and TetB carriage in E. coli isolates from UTI and diarrhea patients in Zaria, Nigeria.

Keywords

Tetracycline resistance; E. coli; UTI and Diarrhea; Multidrug resistance

Introduction

Multidrug resistance (MDR) among pathogenic Escherichia coli is one of the leading causes of increased mortality and morbidity, which has contributed majorly to public health problems in both developed and developing countries. Pathogenic Escherichia coli develop MDR due to their capacity to acquire different genetic markers by horizontal gene transfer especially conjugation [1]. Resistance to Glycylcyclines (Tetracycline) has been associated with multimeric antiporter proteins (Tet proteins A, B, C, L and M), embedded in the bacterial inner membrane, which in exchange for a proton, catalyze the outward transport of tetracycline-Mg2+ complexes from the cytosol. Tet proteins actively efflux antibiotics out of the microbial cell membrane and protect the ribosome DNA, which lead to multidrug resistance [2,3]. Tetracycline enters bacterial cells by passive diffusion across the outer membrane through porin channels, which are composed of the OmpF protein. Transport of the antibiotic across the cytoplasmic membrane and into the cytoplasm requires pH or electropotential gradients [4]. These Tets genes have been transferred to a large variety of Gram-negative bacteria (Salmonella enterica [5], Acinetobacter baumannii [6], Escherichia coli [7], and P. aeruginosa [8]) and Gram positive bacteria (Lactobacillus spp. [9]) due to horizontal gene transfer. Two mutations in the largest cytoplasmic loop of the efflux pump, which resulted from a double frame shift in codons 201, 202 and 203 have been reported to increase the MIC of Tigecycline in Escherichia coli [10], contributing largely to antibiotics resistance. These mechanisms have incapacitated broad spectrum antibiotics such as Tetracycline, Tigecycline and minocycline [11]. Isolates that coded for Tetracycline resistance genes have been reported in food sample (tet(M) and tet(L)); rivers, lakes, seawater, catfish, cows and clinical settings (tetA, tetB, tetC,) [3,11-13]. This has indeed generated a public health concern, due to limited number of antibiotics produced by pharmaceutical industries and low innovative research and limitations associated with clinical trials, which influence the availability of antibiotics for clinical use. Hence, surveillance to monitor the development and prevalence of resistance mechanisms against developed antibiotics is necessary. This study therefore evaluates the level of Tetracycline resistance in Escherichia coli among UTI and diarrhea patients in Zaria, Nigeria.

Methodology

Sample collection

One hundred and thirty two presumptive clinical isolates of E. coli were randomly collected from 4 hospitals within Zaria metropolis for the period of 6 months (April-September, 2014). Using MicrobactTM 12E Gram negative identification kit, 87 of the isolates were confirmed as E. coli.

Antibiotic susceptibility testing

The antibiotic susceptibility profile of the identified E. coli isolates to Tetracycline and some other 14 selected antibiotics were carried out using Kirby-Bauer [14] disc diffusion method and their corresponding results were interpreted using CLSI [15]. Multiple antibiotic resistance index and classification into different subclass of multidrug resistance were carried out using the methods described by Paul et al. [16] and Magiorakos et al. [17] respectively.

Molecular analysis

The DNA of MDR E. coli that were resistant to Tetracycline from UTI and Diarrhea patients in Zaria, Nigeria were extracted using Zymo Research DNA extraction kit with Lot No: ZRC182717 while the PCR was carried out at the Department of Bioscience, International Institute of Tropical, Agriculture, Ibadan using the primers for tetA (Forward: GTAATTCTGAGCACTGTCGC and Reverse: CTGCCTGGACAACATTGCTT ) of 937 base pair and tetB (Forward: CTCAGTATTCCAAGCCTTTG and Reverse: CTAAGCACTTGTCTCCTGTT) of 416 base pair for the amplification of the corresponding genes.

Results and Discussion

Occurrence rate of Escherichia coli from UTI and Diarrhea patients within Zaria, Nigeria for the period of 6 months (April-September, 2014), were carried out in 4 hospitals, and 132 presumptive Escherichia coli were recovered. Significant numbers of the isolates [65.2% (86)] were confirmed to be Escherichia coli {active Escherichia coli (62.2% (82) and slow lactose fermenting Escherichia coli (inactive) [3% (4)]}, while 34.8% (46) were other Enterobacteriacea (Table 1). Sixty eight point six percent {68.6% (59)} of the isolates were resistant to Tetracycline while 31.4% (27) were not resistant to it. The antibiotic susceptibility profile of the Tetracycline resistant isolates showed that Imipinem (1.2%), Amikacin (5.1%), Ceftriaxone (27.1%), Nitrofurantoin (28.8%), Azetronam (42.4%) and Gentamicin (49.2%) were the most effective antibiotics for the treatment of Tetracycline resistant Escherichia coli in Zaria, Nigeria. The isolates were mostly resistant to antibiotics such as Amoxicillin (93.2%), Cefpodoxime (88.1%), Cefotaxime (84.7%), Cefpirome (64.4%), and Sulphamethonidazole-Trimethroprim (61%) while mid resistance was observed against Flouroquinolones (Ciprofloxacin (54.2%) and Ofloxacin (54.2%)) (Table 2). Significant percentages (35.6% (21)) of the isolates were also observed to show resistance against Gentamicin, Ciprofloxacin and Amoxicillin respectively (Table 2).

S/N Hospitals Sampled (n=4) Diarrhea (S) UTI (U) Total Isolates Collected
    Isolates collected E. coli (%) Isolates collected E. coli (%)  
1 ABUTH 15 11 (73.3) 28 21 (75) 43 (32.6)
2 ABUSB 12 7 (58.3) 22 15 (68.2) 34 (25.7)
3 SLAH 10 8 (80) 19 9 (47.4) 29 (22)
4 HGSGH 9 6 (66.7) 17 9 (52.9) 26 (19.7)
  Total 46 32 (69.6) 86 54 (62.8) 132 (100)
S/N: Serial Number; S: Stool sample of diarrhea patients; U: Urine sample of UTI patients; ABUTH: Ahmadu Bello University Teaching Hospital, Shika; ABUSB: Ahmadu Bello University Sick Bay; SLAH: St. Luke Anglican Hospital, Wusasa; HGSGH: HajiyaGamboSawaba General Hospital, Kofan-Gayan

Table 1: Occurrence rate of E. coli in diarrhea and urinary tract infections in Zaria, Nigeria. The result below showed the percentages of E. coli from diarrhea and UTI in each hospital sampled in Zaria, Nigeria.

S/N Isolates Codes Antibiotic S Resistance Pattern NAR Tet. MIC (μg/ml) Class of Antibiotics Resistance LOR GRT MARI
1 THU1 OFX, ATM, CN, CPD, CRO, CPO, CTX, SXT, C, AML 11 128 FLU, MON, AMIN, CEPH, MISC, PEN XDR 6 0.8
2 THU10 OFX, ATM, CN, CIP, CRO, CPD, CPO, CTX, SXT,F, AML 11 128 FLU, AMIN, MON, CEPH, MISC, PEN XDR 6 0.8
3 THU25 OFX, ATM, CN, CIP, CRO, CPD, CPO, CTX, SXT, C, AML, F 12 256 FLU, MON, AMIN, CEPH, MISC, PEN XDR 6 0.9
4 THU27 OFX, CN, CIP, CRO, CPD, CPO, CTX, SXT, AML, F 10 128 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.8
5 THS12 CN, OFX, ATM, CIP, CRO, CPD, CPO, CTX, SXT, C, AML 11 128 FLU, MON, AMIN, CEPH, MISC, PEN XDR 6 0.8
6 THS1 OFX, CN, CIP, CPD, CPO, CTX, SXT, C, AML 9 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.7
7 THS8 CN, OFX, ATM, CIP, CRO, CPD, CPO, CTX, SXT, C, AML 11 128 FLU, MON, AMIN, CEPH, MISC, PEN XDR 6 0.8
8 THS15 CN, OFX, CIP, CPD, CPO, CTX, SXT, AML 8 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.6
9 SBS1 CN, OFX, CIP, CPD, CPO, CTX, SXT, C, AML 9 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.7
10 SBS7 CN, OFX, CIP, CPD, CPO, CTX, SXT, C, AML, IPM 10 128 FLU, AMIN, CEPH, MISC, PEN, CAB XDR 6 0.8
11 SBS11 CN, OFX, CIP, CPO, CTX, SXT, AML 7 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.5
12 SBU2 CN, OFX, CIP, CPD, CPO, CTX, SXT, AML 8 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.6
13 SBU8 CN, OFX, CIP, CPO, CTX, SXT, AML 7 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.5
14 SBU12 CN, ATM, OFX, CIP, CRO, CPD, CPO, CTX, SXT, C, AML, F 12 256 FLU, MON, AMIN, CEPH, MISC, PEN XDR 6 0.9
15 SBU13 CN, ATM, OFX, CIP, CRO, CPD, CPO, CTX, SXT, C, AML 11 128 FLU, MON, AMIN, CEPH, MISC, PEN XDR 6 0.8
16 SBU15 CN, OFX, CIP, CPD, CPO, CTX, SXT, C, AML 9 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.7
17 SBU16 CN, ATM, OFX, CIP, CPD, CPO, CTX, SXT, C, AML 10 128 FLU, MON, AMIN, CEPH, MISC, PEN XDR 6 0.8
18 SBU17 CN, OFX, CIP, CPD, CPO, CTX, SXT, AML 8 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.6
19 SBU20 CN, OFX, CIP, CPD, CPO, SXT, C, AML 8 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.6
20 SLS6 OFX, CIP, CN, CRO, CPO, CTX, AML 7 64 FLU, AMIN, CEPH, PEN MDR 4 0.5
21 SLU3 OFX, CIP, AK, F, SXT, CXT, AML 8 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.6
22 HGS5 CN, ATM, OFX, F, CPD, CPO, CTX, SXT, AML 10 128 FLU, MON, AMIN, CEPH, MISC, PEN XDR 6 0.8
23 HGS6 CN, ATM, OFX, CIP, F, CPD, CTX, AML 8 64 FLU, MON, AMIN, CEPH, MISC, PEN XDR 6 0.6
24 HGU1 CN, OFX, CIP, CPD, CPO, CTX, SXT, AML 8 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.6
25 HGU16 CN, ATM, OFX, CIP, CRO, CPD, CTX, C, AML 9 64 FLU, MON, AMIN, CEPH, MISC, PEN XDR 6 0.7
26 SBU22 CPD, CPO, AML 3 16 CEPH, PEN NIL 2 0.2
27 SLS1 CPO, CTX, SXT, AML 4 16 CEPH, MISC, PEN MDR 3 0.3
28 SLS2 AML 1 8 P NIL 1 0.1
29 SLS3 CPD, CPO, CTX, SXT, AML 5 32 CEPH, MISC, PEN MDR 3 0.4
30 SLS5 OFX, CIP, CN, CRO, CPO, CTX, C 7 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.5
31 SLS8 AK, CRO, ATM, CPO, CXT 5 32 MON, AMIN, CEPH MDR 3 0.4
32 SLS9 CPO, CTX, AML 3 16 CEPH, PEN NIL 2 0.2
33 SLU2 CPO, CTX, SXT, 3 16 CEPH, MISC NIL 2 0.2
34 SLU3 OFX, CIP, AK, F, SXT, CXT, AML 8 64 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.6
35 SLU4 CPD, CPO, C, AML 4 16 CEPH, MISC, PEN MDR 3 0.3
36 SLU7 CPD, CPO, ATM 4 16 CEPH, MON NIL 2 0.3
37 SLU8 OFX, CIP, CPD, CPO, ATM, AML 6 32 FLU, MON, CEPH, PEN MDR 4 0.5
38 HGS2 CN, F, CPD, CPO, SXT, AML 6 32 AMIN, CEPH, MISC, PEN MDR 4 0.5
39 HGS3 ATM, CPD, CTX, AML 4 16 CEPH, MON, PEN MDR 3 0.3
40 HGS4 ATM, CPD, CPO, CTX, AML 3 16 CEPH, MON, PEN MDR 3 0.2
41 HGU4 F, CPO, SXT, AML 4 16 CEPH, MISC, PEN MDR 3 0.3
42 HGU6 C, CXT, AML 3 16 CEPH, AMIN, PEN MDR 3 0.2
43 HGU7 ATM, F, CPD, CPO, CTX, SXT, AML 7 64 MON, CEPH, MISC, PEN MDR 4 0.5
45 HGU9 F, CRO, CPD, CPO, CTX, AML 6 64 MON, CEPH, MISC, PEN MDR 4 0.3
46 HGU14 ATM, F, CPD, CPO, CTX, AML 6 64 MON, CEPH, MISC, PEN MDR 4 0.5
47 THU3 ATM, CPO, CTX, SXT, AML 5 64 CEPH, MISC, PEN MDR 3 0.5
48 THU5 CPO, CTX, SXT, C, AML 5 64 MON, CEPH, MISC, PEN MDR 4 0.4
49 THU6 ATM, CRO, CPO, CTX, C, AML 6 64 MON, CEPH, MISC, PEN MDR 4 0.4
50 THU7 OFX, CIP, CPD, CPO, CTX, SXT, C, AML 8 64 FLU, CEPH, MISC, PEN MDR 4 0.5
51 THU8 OFX, ATM, CIP, CPD, CPO, CTX, AML 7 64 FLU, MON, CEPH, PEN MDR 4 0.6
52 THU9 CPD, CPO, CTX, AML 4 16 CEPH, PEN NIL 2 0.5
53 THU13 OFX, ATM, CIP, CRO, CPD, CPO, CTX, C, AML 9 64 FLU, MON, CEPH, MISC, PEN XDR 5 0.3
54 THU14 ATM, CPO, CTX, C, AML, F 6 32 MON, CEPH, MISC, PEN MDR 4 0.7
55 THU17 CPO, CXT, F, AML 4 16 CEPH, MISC, PEN MDR 3 0.5
56 THU18 CPO, CTX, SXT, C, AML 5 32 CEPH, MISC, PEN MDR 3 0.3
57 THU19 OFX, ATM, CIP, CRO, CPD, CPO, CTX, SXT, AML, F 10 128 FLU, AMIN, CEPH, MISC, PEN XDR 5 0.4
58 THU20 CPO, CTX, SXT, C, AML 7 64 FLU, AMIN, CEPH, PEN MDR 4 0.8
59 THU21 ATM, CN, CPD, CPO, CTX, AML 6 32 MON, AMIN, CEPH, PEN MDR 4 0.5
                0.5

Table 2: Antibiotics susceptibility profile and pattern of Tetracycline resistance E. coli from UTI and Diarrhea patients in Zaria, Nigeria.

This study concur with the report of Okunola et al. [18] in Benin, and Rabasa et al. [19] in Marduguri who reported that E. coli associated infections are becoming highly untreatable due to antibiotics resistant, especially to the first line empirical antimicrobials such as Beta-lactames, Sulphanidazole/Trimethroprim, Nitrofuratoin and Nalidixic acid. The sensitivity of E. coli to Imipeneme, Amikacin, Ceftriazone, Gentamicin and Quinolones as observed in this study may be due to the fact that the Imipeneme and Amikacine are expensive and not commonly sold over the counter while Quinolones are rarely prescribed for children. The parenteral routes of Ceftriazone and Gentamicin reduce the abuse of these two antibiotics. Also concentration dependent bactericidal activity, extended post-antibiotic effect, and the possibility of reduced nephrotoxicity and ototoxicity also affect the recommendation of Gentamicin [20]. The susceptibility of E. coli to Ofloxacin and Ciprofloxacine observed in this study also concurs with the study of Kemebradikumo et al. [21] in Bayelsa, who reported 61.5% E. coli sensitivity to Ofloxacin and 75% for Ciprofloxacin. The slight variation in the sensitivity Quinolones observed in this study might be due to high prescription of Ciprofloxacine in this area compared to Ofloxacin. The Tetracycline resistant E. coli using disc diffusion method was also observed to have high resistant MIC values against Tetracycline (Table 2). Factors such as low patient compliance, menace of substandard antibiotics which is common in developing countries, self-medication, and potentially sub-therapeutic prescription by health workers are some of the factors influencing multiple antibiotics resistance [22]. The MARI result showed that 23.7% (14) of the isolates have ≤ 0.3 MARI while 76% (45) had MARI ≥ 0.4 (Table 2). Classification of the isolates to different levels of resistance showed that 40.7% (24) of the isolates were multidrug resistance (resistance to 4 groups of antibiotics), 47.5% (28) were extensively drug-resistant (resistance to 5 or more than 5 antibiotics groups) while 11.8% (7) were neither MDR nor XDR (Figure 1). The high percentage of E. coli having MAR index ≥ 0.4 (Tables 2) in this study, suggests that the isolates originated from a high risk source of contamination where antibiotics are often used [23], while the high percentage of XDR and MDR (Figure 1) might be an indication that a large proportion of the bacterial isolates have been pre-exposed to several antibiotics, and also, a combination of microbial characteristics such as selective pressure on antimicrobial usage, societal and technological changes that enhance the transmission of drug resistant organisms might be the cause of this high resistance [24]. To validate that the phenotypic resistance of the isolates to Teteracycline is also coded in the isolates genome, and to substantiate that efflux pumps mechanism which triggers the extrusion of structurally unrelated antibiotics from within the cells into the external environment and encourages multidrug resistance is involved in Tetracycline resistance mechanism, molecular analysis was carryout on the E. coli isolates (21) that were simultaneously resistant to Gentamicin, Amoxicillin and Ciprofloxacin using polymerase chain reaction and tetA and tetB primers. The result showed that 95% (20) of the isolates of E. coli have tetA gene compared to 90.5% (19) tetB gene. This virulent genes were however higher than that observed by Nahid et al. [25], who reported 49% tet(A) and 51% tet(B) genes, both of which encode for efflux pumping mechanisms. The antibiotics susceptibility pattern of the isolates also concur that tet(B)-positive strains appeared to be more virulent than tet(A)-positive strains [25]. This is due to the level of antibiotic resistance observed in carriers in this study. Documentary evidence have shown that strains that were tet(B)-or tet(A)-positive might also carry the genes for P fimbriae, iron-trapping compounds, hemolysin and aerobactin, respectively, more often than susceptible strains [25]. These acquirable virulent characteristics enable extra-intestinal pathogenic E. coli to adapt, colonize and persist in adhesion to urinary tract compared to other uropathogens [11,12] (Figures 2 and 3).

clinical-microbiology-Multidrug-resistant

Figure 1: Percentage classification of E. coli isolates to different levels of antibiotics resistance. MDR: Multidrug-resistant; XDR: Extensively drug-resistant; NIL: Neither MDR nor XDR.

clinical-microbiology-resistant-Nigeria

Figure 2: DNA extraction from tetracycline resistant E. coli isolated in Zaria, Nigeria.

clinical-microbiology-Multiplex-Results

Figure 3: Multiplex Results of TetA and TetB Genes.

Conclusion

This study showed the presence of Tetracycline resistant E. coli in UTI and diarrhea patients in Zaria, Nigeria. Resistance to Tetracycline is highly associated with the presence of Tet proteins and isolates with Tet B protein were observed to be more resistant to those with TetA protein. Antibiotic surveillance to monitor the development and prevalence of resistance mechanisms against developed antibiotics is therefore necessary in this environ. Also awareness is important to encourage patient compliance, reduction in substandard antibiotics production in developing countries, reduced self-medication, and potentially sub-therapeutic prescription by health workers are some of the factors that should be curb to reduce multiple antibiotics resistance in Zaria, Nigeria.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 8469
  • [From(publication date):
    December-2015 - Aug 16, 2017]
  • Breakdown by view type
  • HTML page views : 8319
  • PDF downloads :150
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords