alexa The Asterias Rubens Complement System: Comparisons with Lower Vertebrates | Open Access Journals
ISSN: 2157-7013
Journal of Cell Science & Therapy
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

The Asterias Rubens Complement System: Comparisons with Lower Vertebrates

Michel Leclerc1* and Nicolas Kresdorn2

1Rue Isabelle, Romée 45640 Sandillon, France

2GenXPro, Frankfurt, Germany

*Corresponding Author:
Michel Leclerc
Immunologie des Invertébrés
Université d’Orléans 45100
Orleans Cedex 2, France
Tel:
0238410209
E-mail: [email protected]

Received date: November 01, 2014 Accepted date: January 12, 2015 Published date: January 15, 2015

Citation: Leclerc M, Kresdorn N (2016) The Asterias Rubens Complement System: Comparisons with Lower Vertebrates. J Cell Sci Ther 7:236. doi:10.4172/2157-7013.1000236

Copyright: © 2016 Leclerc M, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Cell Science & Therapy

Abstract

Seven complement components have been discovered in 2013, when compared to mouse genome. Another component: the C6 component was found in sea star, when compared to rainbow trout genome:”Oncorhynchus mykiss”.

Keywords

Invertebrate innate; Adaptative immunity

Introduction

We have recently described the” Sea star complement Evidence” [1]. We remarked that C6 and C7 components were missing in sea star transcriptome when compared to mouse one.

An extensive study allowed us to research these components in less evolved animals (phylogenetically speaking) than mouse. Genomic features of the rainbow trout: Oncorhynchus mykiss have helped us, in this study.

At this point, we were attempting to determine how many similar complement components might be present in Asterias rubens (Invertebrate) and in Oncorhynchus mykiss (Vertebrate).

Materials and Methods

Sea stars Asterias rubens were obtained from the Biology Institute (Gothenbugh University)

Immunizations, genomic studies were already described [1]. After ligation of adapters for Illumina’s GSII sequencing system, the cDNA was sequenced on the Illumina GSII platform sequencing.

1.100 bp from one side of the approximately 200 bp fragments. Sequences were assembled using Velvet (Zerbino and Birney [2].

Results

Three complement components: C1r, C4, C1 inhibitor of the classical activation pathway have been fully sequenced in rainbow trout [3].

C6 was discovered in trout in 2006 [4].

Sea star C1q subunits A, B, C, were sequenced in A. rubens [1].

C2, C4B, and C3 which is central in mammals to both the classical and alternative pathways, C9,

C5, C8 were also sequenced [1] in Asterias rubens

As for C6, it was shown as following, when compared to Oncorhynchus mykiss genome:

One contig (Contig11285|m.9708) could be annotated via BLASTX to Oncorhynchus mykiss “Complement component C6” from the Trembl database, with an e-value of 3.75e-13. On an aligned region of 113 amino acids, 37 positive and 56 identical amino acids were found.

5’GACAAATTCGACACTTACAAAAAGCATCTCAACCCGAGTAGGAAGGAATCTCTTTTAGTT

GCAGTAAATTTTGAATTTGTATAATTCAGTATTTTGTGCTCCCTTTGGTATCAGTTTAGA

TCCACACAACCTGTGAAAAACTTCAGTACTTACTAGATTTCGCCAACGCAACGGTAAACG

AGTCATTTGATTTTGACCATCATCAACTGAAGCAACGCACGTAATACACACAACAAACGG

AACATTTTGTGTGTAGTTTCCAGCGATTCGAGAAGCAAATCAAAGACAAGATGTCTTTAC

CCAGTGATGTTGAAACAGACTCCGTCATGGATAGTCCAGCAGAGATTCATATGAACATGA

ATAAGCTACAATCTAAACTTCCCAGCGTTACTCAAGACGAGAGATTTGACTCCGGAATTG

ACTCGTTACGTTCTGTTGATTCGGCGTACTGCTTGAGCTTCGAAAGGGAATCGAGCCTGG

CTTCGATAAATGAGAAGACGTCTCTCACATCACACCTGCAACAGCTCCATCTTTCACATG

AAACAAGAACAGAAACCGAGAAGACTGAAACGACAGTAGAAGACATCGATGAAGCTTATC

ATGATGAGTGTACTATGTCTGAAACACTCGACAATTTGGAAGAAACTGCAAGAATTGTGG

AATATCCTGAACAAAGATGCACGGGACGTCTTACAGATGATGCCTTCGACCAAGACCAAG

AGGGAGATACGCCCCTTCATCTTGCTATTATTCATAAGGAAGTGGACTTCGCAGAAAAAT

TCATCATCTTTGTTGCAGATCCTGAGTTACTGAACATCAGCAATGATCTTATGCAGACTC

CTTTACACCTTAGCGTATTAACAAGGCAACAAGATATCTGTCGTGTTCTCGTCTTGGGCA

ATGCCCAAATCGACTGCACCGACCGAAACGGCGACACTCCTCTTCATATTGCATGCAGAC

TGAGAGATGAGGGCTGTATCAGAGCTCTGACTGAAGGAATATCTCCACTCGAGCGTAAGA

GAGGGATGGTTCCACAGAATAGAGCAAGTGGGGTACAACAGCTTCCACAGAATCTTGAAC

TCAGAAACTTTGAAGGCTACACATGCATCCATATTGCAGGATTCGCTTGTAGCGTCGATC

AGTTGGAGTACCTTGTGCAGCTAGGCGGCGACATAAATGCCCCGGATGGAAAGAGCGGAA

GGACCATTCTCCACTACGCTGTAGAGGCGGGTGACTTTTCTCTTTGTCAGTACCTCATTG

CGAACTTGGGTGCCAATGTTAATGCGTTGACCTTTGACCAGTGCACACCC3’

C7 was not found.

Discussion and Conclusion

The sea star A. rubens, although considered to be more primitive than lower vertebrates (as trout) seems to have evolved much more sophisticated immune defense mechanisms.

We find much more complement components in the sea star than in trout: 8 out of 9, when compared to mouse. How do we explain these differences between trout and A. rubens? Phylogenetically speaking the sea star could be situated in “an evolutive cul de sac”and might evolved more quickly than rainbow trout, in term of innate immunity. As for adaptative immunity, rainbow trout is more evolved than Asterias rubens which presents an “invertebrate primitive antibody” in response to antigenic injury [5,6]. This review has described a rather rich catalogue of immune factors in sea star and trout that serve as potent molecules in the defense of these animals against environmental threats. Taken together one cannot come away with any conclusion other than sea stars have developed a very impressive set of mechanisms to deal with environmental threats. The same logic would apply to an explanation of why the sea star A. rubens has evolved the ability to develop innate and adaptative immunity. Further studies are bound to unravel the mystery and add to the above information to give a clearly picture of the sequence of events.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 7773
  • [From(publication date):
    February-2016 - Jun 25, 2017]
  • Breakdown by view type
  • HTML page views : 7731
  • PDF downloads :42

Review summary

  1. Salsabyl
    Posted on Oct 05 2016 at 1:52 pm
    The document is a significant addition to the scientific literature in this field.
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords