alexa The Q-B Solution | OMICS International
ISSN: 2375-4389
Journal of Global Economics
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

The Q-B Solution

Paul T E Cusack*

1641 Sandy Point Rd, Saint John, NB, Canada E2K 5E8, Canada

*Corresponding Author:
Cusack PTE
Independent Researcher
BSc E, DULE, 1641 Sandy Point Rd
Saint John, NB, Canada E2K 5E8
Canada
Tel: (506) 214-3313
E-mail: [email protected]

Received Date: January 17, 2017; Accepted Date: February 20, 2017; Published Date: February 27, 2017

Citation: Cusack PTE (2017) The Q-B Solution. J Glob Econ 5:237. doi:10.4172/2375-4389.1000237

Copyright: © 2017 Cusack PTE. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Global Economics

Abstract

In this paper, we use Euler’s Formula and Astrotheology Physics to determine the mathematical mechanism that may be used by the Fed. Chairman to set interest rates and projected inflation. I call this “Cusack-Bernanke Solution “or the “Q-B Solution.”

<p>omicsonline.org</p>
<h4>Keywords</h4>
<p>Rhizobacteria; Nodule associated bacteria; Nitrogen   fixation; Phylogenetics</p>
<h4>Background</h4>
<p>A large proportion of the population in Western Kenya is involved   in agricultural production and the common bean is one of the major   crop grown [<a href="#1" title="1">1</a>]. Due to a rapid increase in population growth, there is   a high demand for food production, hence farms are repeatedly used.   This habit has greatly reduced soil fertility and bred more   phytopathogens resulting to very low yield [<a href="#2" title="2">2</a>]. In order to increase the   crops yields, farmers have therefore resorted to the intensive use of   inorganic fertilizers in an attempt to boost fertility in their farms and   use of pesticides to reduce damage by phytopathogens. Inorganic   fertilizers and pesticides may increase the accumulation of heavy   metals in the soil and plant systems [<a href="#3" title="3">3</a>]. <a href=https://www.omicsonline.org/inorganic-chemistry-journals-conferences-list.php" target="_blank">Inorganic</a> fertilizers mainly   contain ammonia, phosphates, potassium and nitrate salts. These salts   reach the water bodies through leaching, drainage, and flow. Water   pollution by these inorganics constitutes a major concern globally as it   may lead to the onset of many fatal diseases in humans, direct killing   of aquatic animals, eutrophication in water bodies and   bioaccumulation of these toxic compounds in food trophic levels [<a href="#4" title="4">4</a>].</p>
<p>The economic consequences of the application of inorganic   fertilizers together with their negative impacts on the environment   have become a concern globally thus, there is a need for farmers to   shift to the farming practices that are sustainable [<a href="#5" title="5">5</a>]. Studies have   shown that the use of plant growth promotion rhizobacteria (PGPR)   can significantly increase the yield of common bean [<a href="#6" title="6">6</a>-<a href="#9" title="9">9</a>] and hence it   is a potential alternative to heavy dependency on inorganic fertilization   and use of pesticides. The mechanisms by which these soil   microorganisms promote plant growth are not well elucidated but   nitrogen fixation [<a href="#10" title="10">10</a>-<a href="#12" title="12">12</a>], phosphorus solubilization [<a href="#13" title="13">13</a>,<a href="#14" title="14">14</a>] and   inhibition of phytopathogens growth [<a href="#15" title="15">15</a>,<a href="#16" title="16">16</a>] are thought to be a   possible explanation for this effect. The belief that only rhizobia   colonize nodules of leguminous plants is disputable. Researchers have   been isolating other <a href=https://www.omicsonline.org/microorganisms-journals-conferences-list.php" target="_blank">microorganisms</a> besides rhizobia as bona fide   members of nodules in the legumes [<a href="#6" title="6">6</a>,<a href="#17" title="17">17</a>]. They have demonstrated   the isolation of bacteria of several genera; <em>Pseudomonas, Aerobacter,     Agrobacterium, Chryseomonas, Bacillus, Curtobacterium, Erwinia,     Enterobacter, Sphingomonas , </em>and<em> Flavimonas</em> . The presence of these   bacteria in the nodules is not accidental. Available reports over time   have shown that co-inoculation of rhizobia with other rhizobacteria   tremendously increased the yield of common beans compared to when rhizobia were the only inoculant in terms of increased number of pods   per plant, the number of seeds per pod, weight of pods per plant and   total dry matter of the shoot [<a href="#18" title="18">18</a>]. Rajendran et al. [<a href="#19" title="19">19</a>] reported an   increased nodulation and root weight in greenhouse conditions when   common beans were co-inoculated with rhizobia together with other   nodule associated bacteria. Nodule associated bacteria that so far have   been co-inoculated with rhizobia include <em>Azospirillum</em> [<a href="#20" title="20">20</a>], <em>Azotobacter , Bacillus</em> [<a href="#21" title="21">21</a>] and <em>Pseudomonas</em> [<a href="#13" title="13">13</a>]. All these   experiments resulted in increased yields due to improved <a href=https://www.omicsonline.org/nutrition-food-sciences.php" target="_blank">nutrient</a> availability and plant health.</p>
<p>Various studies have found that plant growth-promoting   rhizobacteria (PGPR) strains vary widely in different soils and their   ability to promote growth may be highly specific to particular species,   cultivar, soil and genotype [<a href="#17" title="17">17</a>]. Under such circumstances, knowledge   of native bacterial population and their identification is important for   understanding their distribution and diversity [<a href="#22" title="22">22</a>]. It is important to   explore and identify region-specific microbial strains which can be   used as potential plant growth promoters to achieve higher yields   under specific <a href=https://www.omicsonline.org/ecological-conservation-top-open-access-journals.php" target="_blank">ecological</a> and environmental conditions. There are no   published studies that characterized the rhizobacteria in the soils of   Western Kenya associated with nodules of <em>Phaseolus vulgaris</em> and   therefore efforts to establish inoculants that are specific for these soils   have been elusive. Information concerning the genetic diversity and   distribution of these important microbes is thus necessary for the   production of PGPR inoculants specific for this region.</p>
<p><a href=https://www.omicsonline.org/molecular-genetic-medicine.php" target="_blank">Molecular</a> techniques have successfully been used in examining   microbial identity and diversity [<a href="#23" title="23">23</a>]. Mostly these studies have utilized   sequence analysis of 16SrRNA gene which is highly conserved in all   prokaryotes [<a href="#24" title="24">24</a>,<a href="#25" title="25">25</a>]. The conservation of this gene has enabled   synthesis of primers that target various taxonomic groups but have   enough variations to give phylogenetic comparisons of different   microbial communities [<a href="#26" title="26">26</a>,<a href="#27" title="27">27</a>].</p>
<p>The composition of microbial communities can be analyzed based   on profiles generated from physical separation of 16SrRNA gene   sequences on the gel [<a href="#23" title="23">23</a>]. These techniques detect different sizes of   PCR-amplified 16SrRNA gene fragments. Direct sequencing of   16SrRNA gene has been employed in establishing genetic relationships   and characterization of strains at the generic or higher level [<a href="#28" title="28">28</a>].   Sequencing techniques have increased tremendously due to the   invention of next-generation sequencing that has reduced the cost of   sequencing [<a href="#29" title="29">29</a>] making the technique affordable even to low income   researchers.</p>
<h4>Methods</h4>
<p><strong>Study site</strong></p>
<p>Nodules of common beans were collected from farmers&rsquo; fields in   which there is no history of inoculation with any nodule associated   bacteria but in which common bean has been grown frequently.   Nodules were collected from the slopes of Mt. Elgon, shores of Lake   Victoria at Kisumu and Kakamega. At the shores Lake Victoria,   nodules were collected from farm A (S 00&deg; 08.729&rsquo;; E 034&deg; 69.596&rsquo;),   Farm B (S 00&deg; 08.828&rsquo;; E 034&deg; 69.654&rsquo;), Farm C (S 00&deg; 08.852&rsquo;; 034&deg;   69.654&rsquo;) and Farm D (S 00&deg; 09.094; E 034&deg; 69.715&rsquo;), all in Korando sublocation   in Kisumu County. At Mt. Elgon region, soils were collected   from Farm A (S 00&deg; 79.209&rsquo;; E 034&deg; 63.688&rsquo;), Farm B (S 00&deg; 77.913&rsquo;; E   034&deg; 64.030&rsquo;), Farm C (S 00&deg; 81.852&rsquo;; 034&deg; 61.654&rsquo;) and Farm D (S 00&deg;   82.094; E 034&deg; 59.715&rsquo;), all in Kapkateny sub-location in Bungoma County. At Kakamega, soils and nodules were collected from Farm A   (S 00&deg; 19.570&rsquo;; E 034&deg; 65.921&rsquo;), Farm B (S 00&deg; 20.779&rsquo;; E 034&deg; 65.663&rsquo;),   Farm C (S 00&deg; 18.982&rsquo;; 034&deg; 68.534&rsquo;) and Farm D (S 00&deg; 18.715; E 034&deg;   68.607&rsquo;), all in Kakamega South sub-county in Kakamega County.   Collection strategy employed the randomized technique in which   nodules were collected six meters apart following a W pattern running   across the whole plot. Three common bean plants were collected from   each site. The uprooted plants were packed in khaki bags and   transported to the Microbiology laboratory at Masinde Muliro   University of Science and Technology, Kenya for analysis.</p>
<p><strong>Isolation of nodule associated bacteria</strong></p>
<p>Nodule associated bacteria were isolated from surface-sterilized   nodules according to the method described by Rincon et al. [<a href="#30" title="30">30</a>]. The   nodule surfaces were first sterilized with 75% ethanol, followed by   0.1% mercuric chloride for about 3 min and then extensively rinsed six   times with sterile distilled water. The water from the sixth rinse was   streaked on <a href=https://www.omicsonline.org/scholarly/yeast-fermentation-journals-articles-ppts-list.php" target="_blank">yeast</a> extract mannitol agar (YMA) to confirm the   complete removal of nodule epiphytes before the nodules were crushed   with a flame-sterilized blunt-tipped pair of forceps. The exudates of the   crushed nodules were cultured on yeast-mannitol agar (YMA)   medium at 28&deg;C for 3 days, and a single colony was selected for further   culture. The validation of the culture purity was performed by repeated   streaking on Yeast extract mannitol agar medium and <a href=https://www.omicsonline.org/clinical-cellular-immunology.php" target="_blank">cellular</a> examination in the microscope. The isolates were then stored in 20%   glycerol at -70&deg;C.</p>
<p><strong>DNA extraction, PCR amplification, and sequencing of   16SrRNA gene</strong></p>
<p>Genomic DNA was isolated using QIAamp&reg; genomic DNA kit   following the manufacturer&rsquo;s instructions and 16SrRNA gene was   amplified using the universal primers, 27f   (5&rsquo;AGAGTTTGATCCTGGCTCAG 3&rsquo;) and 1492r (5'   TACGGCTACCTTGTTACGACTT 3') which are complementary to   conserved regions of the bacterial 16SrRNA gene. Amplification was   carried out in 25 &mu;L reaction volumes containing the following: 2.5 &mu;L   10X PCR reaction buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCl)   and 1.5 &mu;L 25 mM MgCl2 solution, 4.0 &mu;L 1.25 mM, dNTPs, 0.5 &mu;L of   27f primer (200 ng/&mu;L), 0.5 &mu;L of 1492r primer (200 ng/&mu;l), 0.1 &mu;L   AmpliTaq Gold DNA polymerase and 1 &mu;L of DNA as template. The   reaction volume was adjusted up to 25 &mu;L with sterile ultrapure water.   The PCR thermal cycling conditions consisted of an initial   denaturation step at 94&deg;C for 3 min, followed by 30 cycles of   denaturation (1 min at 94&deg;C), annealing for 1 min at 57&deg;C and   extension for 2 min at 72&deg;C, followed by a final extension at 72&deg;C for 8   min. Double distilled water was used as negative control to check for   false positive as a result of contamination of the reagents. PCR   amplified products were separated on 1.0% agarose gels in 1X TBE   buffer at 10 V cm<sup>-1</sup> for 30 minutes.</p>
<p>After the gel was photographed, the bands were located by using   UV lamp, cut out and placed in a 2 mL Eppendorf tube. The PCR   fragments were then extracted from the gel using Qiagen Gel   purification kit following the manufacturer&rsquo;s instruction. Sequencing   reactions were performed at Bioneer, South Korea using the BigDye   Terminator v3.1 sequencing Kit (Applied Biosystems, USA) with the   primers 27f, and 1492r and sequenced products were analyzed using   an automatic sequencer, ABI3730XL (Applied Biosystems).</p>
<p><strong>Phylogenetic data analysis</strong></p>
<p>Consensus sequences of the forward and reverse primers were   generated in BioEdit ver. 7 [<a href="#31" title="31">31</a>] and then nucleotide alignment was   generated by CLUSTAL W [<a href="#32" title="32">32</a>] implemented in BioEdit ver. 7. The   alignment file was then loaded in MEGA 6 where the evolutionary   history was inferred using the Neighbor-Joining method [<a href="#33" title="33">33</a>]. The   bootstrap consensus tree inferred from 1000 replicates [<a href="#34" title="34">34</a>] was taken   to represent the evolutionary history of the taxa analyzed [<a href="#34" title="34">34</a>].   Branches corresponding to partitions reproduced in less than 50 %   bootstrap replicates were collapsed. The evolutionary distances were   computed using the Jukes-Cantor method [<a href="#35" title="35">35</a>] and are in the units of   the number of base substitutions per site. The analysis involved 24   nucleotide sequences. Codon positions included were 1st, 2nd, 3rd and   noncoding. All positions containing gaps and missing data were   eliminated. Evolutionary analyses were conducted in MEGA5 [<a href="#36" title="36">36</a>].</p>
<h4>Results</h4>
<p><strong>Genetic diversity and distribution of nodule associated   bacteria</strong></p>
<p>This study reports a total of 24 strains of rhizobacteria isolated from   common bean nodules, including <em>Delfitia , Rhizobia , Acinetobacter ,     Pseudomonas , Providencia , Enterobacter , </em>and<em> Klebsiella</em> . The 24   sequences submitted to the NCBI GenBank were assigned accession   numbers as shown in <strong>Table 1</strong>.</p>
<div class="table-responsive">
<table class="table table-bordered">
    <thead>
        <tr>
            <th>Organism name</th>
            <th>Strain/sample</th>
            <th>NCBI Accession number</th>
        </tr>
    </thead>
    <tbody>
        <tr>
            <td><em>Enterobacterhormaechei</em></td>
            <td>E1</td>
            <td>KX856071.1</td>
        </tr>
        <tr>
            <td><em>Pseudomonas koreensis</em></td>
            <td>E2</td>
            <td>KX856072.1</td>
        </tr>
        <tr>
            <td><em>Providenciarettgeri</em></td>
            <td>E3</td>
            <td>KX856073.1</td>
        </tr>
        <tr>
            <td><em>Providenciarettgeri</em></td>
            <td>E4</td>
            <td>KX856074.1</td>
        </tr>
        <tr>
            <td><em>Pseudomonas koreensis</em></td>
            <td>E5</td>
            <td>KX856075.1</td>
        </tr>
        <tr>
            <td><em>Providenciarettgeri</em></td>
            <td>E6</td>
            <td>KX856076.1</td>
        </tr>
        <tr>
            <td><em>Enterobacter cloacae</em></td>
            <td>E8</td>
            <td>KX856077.1</td>
        </tr>
        <tr>
            <td><em>Pseudomonas sp.</em></td>
            <td>E9</td>
            <td>KX856078.1</td>
        </tr>
        <tr>
            <td><em>Pseudomonas sp.</em></td>
            <td>E10</td>
            <td>KX856079.1</td>
        </tr>
        <tr>
            <td><em>Enterobacter sp.</em></td>
            <td>K1</td>
            <td>KX856080.1</td>
        </tr>
        <tr>
            <td><em>Klebsiellapneumoniae</em></td>
            <td>K2</td>
            <td>KX856081.1</td>
        </tr>
        <tr>
            <td><em>Providencia sp.</em></td>
            <td>K3</td>
            <td>KX856082.1</td>
        </tr>
        <tr>
            <td><em>Pseudomonas koreensis</em></td>
            <td>K5</td>
            <td>KX856083.1</td>
        </tr>
        <tr>
            <td><em>Enterobacterhormaechei</em></td>
            <td>K6</td>
            <td>KX856084.1</td>
        </tr>
        <tr>
            <td><em>Delftia sp.</em></td>
            <td>K7</td>
            <td>KX856085.1</td>
        </tr>
        <tr>
            <td><em>Rhizobium sp.</em></td>
            <td>S2</td>
            <td>KX856086.1</td>
        </tr>
        <tr>
            <td><em>Delftia sp.</em></td>
            <td>S3</td>
            <td>KX856087.1</td>
        </tr>
        <tr>
            <td><em>Rhizobium sp.</em></td>
            <td>S4</td>
            <td>KX856088.1</td>
        </tr>
        <tr>
            <td><em>Delftia sp.</em></td>
            <td>S5</td>
            <td>KX856089.1</td>
        </tr>
        <tr>
            <td><em>Rhizobium sp.</em></td>
            <td>S6</td>
            <td>KX856090.1</td>
        </tr>
        <tr>
            <td><em>Delftialacustris</em></td>
            <td>S7</td>
            <td>KX856091.1</td>
        </tr>
        <tr>
            <td><em>Delftialacustris</em></td>
            <td>S8</td>
            <td>KX856092.1</td>
        </tr>
        <tr>
            <td><em>Enterobacterasburiae</em></td>
            <td>S9</td>
            <td>KX856093.1</td>
        </tr>
        <tr>
            <td><em>Acinetobactercalcoaceticus</em></td>
            <td>S10</td>
            <td>KX856094.1</td>
        </tr>
    </tbody>
</table>
</div>
<p><strong>Table 1:</strong> NCBI identity of nodule associated bacteria (NAB) obtained   from nodules of common beans.</p>
<p><strong>Phylogenetic analysis</strong></p>
<p>The isolates clustered into five clades on the phylogenetic tree shown   in <strong>Figure 1</strong>, Clade A contained <em>Delfitia spp</em>. With GenBank accession   numbers KX856092.1, KX856091.1, KX856085.1, KX856089.1, and   KX856067.1. Clade B contained <em>Rhizobia</em> spp ., KX856088.1,   KX856090.1, and KX856086.1. Both of these clustered were supported   by 100% bootstrap confidence. Clade C contained members of <em>Pseudomonas</em> spp. with accession numbers KX856083.1, KX856075.1,   KX856079.1, KX856078.1 and KX856078.1 whose branch was   supported by 99% bootstrap confidence. Members of <em>Providencia spp</em>.   formed Clade D with a branch supported by 100% bootstrap   confidence and they included strains with accession numbers   KX856082.1, KX856073.1, KX856076.1, and KX856074.1. Finally, <em>Enterobacter spp</em>. formed Clade E which contained strains with   accession numbers KX856093.1, KX856080.1, KX856084.1,   KX856071.1, and KX856077.1.</p>
<div class="well well-sm">
<div class="row">
<div class="col-xs-12 col-md-2"><a onclick="openimage('https://www.omicsonline.org/articles-images/applied-microbiology-Phylogenetic-clusters-3-128-g001.png','','scrollbars=yes,resizable=yes,width=500,height=330')" class="thumbnail"><img src=https://www.omicsonline.org/articles-images/applied-microbiology-Phylogenetic-clusters-3-128-g001.png" class="img-responsive" alt="applied-microbiology-Phylogenetic-clusters" title="applied-microbiology-Phylogenetic-clusters" /></a></div>
<div class="col-xs-12 col-md-10">
<p><strong>Figure 1:</strong> Phylogenetic tree. Organisms in the same clusters are         genetically similar, while those in different clusters are genetically         different.</p>
</div>
</div>
</div>
<p>Most of the isolates in each genus were genetically diverse with the   exception of only a few members (<strong>Table 2</strong>). Among the genera <em>Enterobacter</em> , all the species were genetically diverse, the maximum   [max] distance was 0.1831 &plusmn; 0.0125 between <em>Enterobacter asburiae</em> strain S9 and Enterobacter cloacae strain E8 while the minimum   evolutionary distance was 0.0761 &plusmn; 0.0077 between <em>Enterobacter</em> <em>hormaechei</em> strain K6 and Enterobacter hormaechei strain E1. The   overall evolutionary distance among members of Enterobacter was   0.1416. Among members of <em>Delfitia</em> , the maximum evolutionary   distance was 0.1183 &plusmn; 0.009 between <em>Delftia sp</em>. strain S3 and <em>Delftia     lacustris</em> strain S7 and <em>Delftia lacustris</em> strain S8. <em>Delfitia lacustris</em> strains S7 and S8 had exactly 0.00 evolutionary distances meaning they   were genetically identical. The overall evolutionary distance of <em>Delfitia</em> was 0.0988. Maximum evolutionary distance among members of   Pseudomonas was 0.2553 &plusmn; 0.0152 between <em>Pseudomonas koreensis</em> strain E2 and <em>Pseudomonas sp</em>. strain E9 and <em>Pseudomonas sp</em>. strain   E10. Genetic distance between <em>Pseudomonas sp</em>. strains E9 and E19   and Pseudomonas koreensis strain K5 and <em>Pseudomonas</em> <em>koreensis</em> strain E5 was 0.00. The overall mean evolutionary distance among members of <em>Pseudomonas</em> was 0.1344. The minimum evolutionary   distance among members of <em>Providencia</em> was 0.1707 &plusmn; 0.0129 between <em>Providencia rettgeri</em> strain E4 and <em>Providencia sp</em>. strain K3 and <em>Providencia rettgeri</em> strain E3. Again, <em>Providencia sp</em>. strain K3 and <em>Providencia rettgeri</em> strain E3 had an evolutionary distance of 0.00   meaning that they were genetically identical. The overall genetic   distance among members of these genera was 0.1269. In <em>rhizobia</em> genera , Rhizobium_sp. Strain S6 and <em>Rhizobium sp</em> . Strain S4 had the   highest evolutionary distance of 0.1375 &plusmn; 0.0115. The overall genetic   distance among members of Rhizobia was 0.1088. It follows that   members of the genera <em>Enterobacter</em> were more diverse and members   of <em>Delfitia</em> were less genetically diverse as shown in <strong>Figure 2</strong>.</p>
<div class="table-responsive">
<table class="table table-bordered">
    <thead>
        <tr>
            <th>Species 1</th>
            <th>Species 2</th>
            <th>Dist.</th>
            <th>Err</th>
        </tr>
    </thead>
    <tbody>
        <tr>
            <td>KX856093.1|<em>Enterobacter asburiae</em>strain S9</td>
            <td>KX856084.1|<em>Enterobacter hormaechei</em> strain K6</td>
            <td>0.1485</td>
            <td>0.0117</td>
        </tr>
        <tr>
            <td>KX856093.1|<em>Enterobacter asburiae</em>strain S9</td>
            <td>KX856080.1|<em>Enterobacter sp.</em> strain K1</td>
            <td>0.0916</td>
            <td>0.0093</td>
        </tr>
        <tr>
            <td>KX856084.1|<em>Enterobacter hormaechei</em>strainK6</td>
            <td>KX856080.1|<em>Enterobacter sp.</em> strain K1</td>
            <td>0.1373</td>
            <td>0.0105</td>
        </tr>
        <tr>
            <td>KX856093.1|<em>Enterobacter asburiae</em>strain S9</td>
            <td>KX856077.1|<em>Enterobacter cloacae</em> strain E8</td>
            <td>0.1831</td>
            <td>0.0125</td>
        </tr>
        <tr>
            <td>KX856084.1|<em>Enterobacter hormaechei</em>strain K6</td>
            <td>KX856077.1|<em>Enterobacter cloacae</em> strain E8</td>
            <td>0.1608</td>
            <td>0.012</td>
        </tr>
        <tr>
            <td>KX856080.1|<em>Enterobacter sp.</em>strain K1</td>
            <td>KX856077.1|<em>Enterobacter cloacae</em> strain E8</td>
            <td>0.1714</td>
            <td>0.0116</td>
        </tr>
        <tr>
            <td>KX856093.1|<em>Enterobacter asburiae</em> strain S9</td>
            <td>KX856071.1|<em>Enterobacter hormaechei</em> strain E1</td>
            <td>0.1457</td>
            <td>0.0122</td>
        </tr>
        <tr>
            <td>KX856084.1|<em>Enterobacter hormaechei</em>strain K6</td>
            <td>KX856071.1|<em>Enterobacter hormaechei</em> strain E1</td>
            <td>0.0761</td>
            <td>0.0077</td>
        </tr>
        <tr>
            <td>KX856080.1|<em>Enterobacter sp.</em> strain K1</td>
            <td>KX856071.1|<em>Enterobacter hormaechei</em> strain E1</td>
            <td>0.1373</td>
            <td>0.0107</td>
        </tr>
        <tr>
            <td>KX856077.1|<em>Enterobacter cloacae</em> strain E8</td>
            <td>KX856071.1|<em>Enterobacter hormaechei</em> strain E1</td>
            <td>0.1646</td>
            <td>0.012</td>
        </tr>
        <tr>
            <td>KX856092.1|<em>Delftia lacustris</em> strain S8</td>
            <td>KX856091.1|<em>Delftia lacustris</em> strain S7</td>
            <td>0</td>
            <td>0</td>
        </tr>
        <tr>
            <td>KX856092.1|<em>Delftia lacustris</em> strain S8</td>
            <td>KX856089.1|<em>Delftia sp.</em> strain S5</td>
            <td>0.113</td>
            <td>0.0089</td>
        </tr>
        <tr>
            <td>KX856091.1|<em>Delftia lacustris</em> strain S7</td>
            <td>KX856089.1|<em>Delftia sp.</em> strain S5</td>
            <td>0.113</td>
            <td>0.0089</td>
        </tr>
        <tr>
            <td>KX856092.1|<em>Delftia lacustris</em> strain S8</td>
            <td>KX856087.1|<em>Delftia sp.</em> strain S3</td>
            <td>0.1183</td>
            <td>0.009</td>
        </tr>
        <tr>
            <td>KX856091.1|<em>Delftia lacustris</em> strain S7</td>
            <td>KX856087.1|<em>Delftia sp.</em> strain S3</td>
            <td>0.1183</td>
            <td>0.009</td>
        </tr>
        <tr>
            <td>KX856089.1|<em>Delftia sp</em>. strain S5</td>
            <td>KX856087.1|<em>Delftia sp.</em> strain S3</td>
            <td>0.1034</td>
            <td>0.0083</td>
        </tr>
        <tr>
            <td>KX856092.1|<em>Delftia lacustris</em> strain S8</td>
            <td>KX856085.1|<em>Delftia sp.</em> strain K7</td>
            <td>0.0965</td>
            <td>0.0083</td>
        </tr>
        <tr>
            <td>KX856091.1| <em>Delftialacustris</em> strain S7</td>
            <td>KX856085.1|<em>Delftia sp.</em> strain K7</td>
            <td>0.0965</td>
            <td>0.0083</td>
        </tr>
        <tr>
            <td>KX856089.1|<em>Delftia sp.</em> strain S5</td>
            <td>KX856085.1|<em>Delftia sp.</em> strain K7</td>
            <td>0.1121</td>
            <td>0.009</td>
        </tr>
        <tr>
            <td>KX856087.1|<em>Delftia sp.</em> strain S3</td>
            <td>KX856085.1|<em>Delftia sp. Strain</em>K7</td>
            <td>0.1165</td>
            <td>0.0088</td>
        </tr>
        <tr>
            <td>KX856083.1|<em>Pseudomonas koreensis</em> strain K5</td>
            <td>KX856079.1|<em>Pseudomonas sp.</em> Strain E10</td>
            <td>0.093</td>
            <td>0.0083</td>
        </tr>
        <tr>
            <td>KX856083.1|<em>Pseudomonas koreensis</em> strain K5</td>
            <td>KX856078.1|<em>Pseudomonas sp.</em> Strain E9</td>
            <td>0.093</td>
            <td>0.0083</td>
        </tr>
        <tr>
            <td>KX856079.1|<em>Pseudomonas sp.</em> Strain E10</td>
            <td>KX856078.1|<em>Pseudomonas sp.</em> Strain E9</td>
            <td>0</td>
            <td>0</td>
        </tr>
        <tr>
            <td>KX856083.1|<em>Pseudomonas koreensis</em> strain K5</td>
            <td>KX856075.1|<em>Pseudomonas koreensis</em> strain E5</td>
            <td>0</td>
            <td>0</td>
        </tr>
        <tr>
            <td>KX856079.1|<em>Pseudomonas sp.</em> strain E10</td>
            <td>KX856075.1|<em>Pseudomonas koreensis</em> strain E5</td>
            <td>0.093</td>
            <td>0.0083</td>
        </tr>
        <tr>
            <td>KX856078.1|<em>Pseudomonas sp.</em> strain E9</td>
            <td>KX856075.1|<em>Pseudomonas koreensis</em> strain E5</td>
            <td>0.093</td>
            <td>0.0083</td>
        </tr>
        <tr>
            <td>KX856083.1|<em>Pseudomonas koreensis</em> strain K5</td>
            <td>KX856072.1|<em>Pseudomonas koreensis</em> strain E2</td>
            <td>0.2305</td>
            <td>0.0147</td>
        </tr>
        <tr>
            <td>KX856079.1|<em>Pseudomonas sp.</em> strain E10</td>
            <td>KX856072.1|<em>Pseudomonas koreensis</em> strain E2</td>
            <td>0.2553</td>
            <td>0.0152</td>
        </tr>
        <tr>
            <td>KX856078.1|<em>Pseudomonas sp.</em> Strain E9</td>
            <td>KX856072.1|<em>Pseudomonas koreensis</em> strain E2</td>
            <td>0.2553</td>
            <td>0.0152</td>
        </tr>
        <tr>
            <td>KX856075.1|<em>Pseudomonas koreensis</em>strainE5</td>
            <td>KX856072.1|<em>Pseudomonas koreensis</em> strain E2</td>
            <td>0.2305</td>
            <td>0.0147</td>
        </tr>
        <tr>
            <td>KX856082.1|<em>Providencia sp.</em> Strain K3</td>
            <td>KX856076.1|<em>Providencia rettgeri</em> strain E6</td>
            <td>0.1301</td>
            <td>0.0108</td>
        </tr>
        <tr>
            <td>KX856082.1|<em>Providencia sp.</em> strain K3</td>
            <td>KX856074.1|<em>Providencia rettgeri</em> strain E4</td>
            <td>0.1707</td>
            <td>0.0129</td>
        </tr>
        <tr>
            <td>KX856076.1|<em>Providencia rettgeri</em> strain E6</td>
            <td>KX856074.1|<em>Providencia rettgeri</em> strain E4</td>
            <td>0.1599</td>
            <td>0.012</td>
        </tr>
        <tr>
            <td>KX856082.1|<em>Providencia sp.</em>StrainK3</td>
            <td>KX856073.1|<em>Providencia rettgeri</em> strain E3</td>
            <td>0</td>
            <td>0</td>
        </tr>
        <tr>
            <td>KX856076.1|<em>Providencia rettgeri</em> strain E6</td>
            <td>KX856073.1|<em>Providencia rettgeri</em> strain E3</td>
            <td>0.1301</td>
            <td>0.0108</td>
        </tr>
        <tr>
            <td>KX856074.1|<em>Providencia rettgeri</em> strain E4</td>
            <td>KX856073.1|<em>Providencia rettgeri</em> strain E3</td>
            <td>0.1707</td>
            <td>0.0129</td>
        </tr>
        <tr>
            <td>KX856090.1|<em>Rhizobium sp.</em> strain S6</td>
            <td>KX856088.1|<em>Rhizobium sp.</em> Strain S4</td>
            <td>0.1375</td>
            <td>0.0115</td>
        </tr>
        <tr>
            <td>KX856090.1|<em>Rhizobium sp.</em> strain S6</td>
            <td>KX856086.1|<em>Rhizobium sp.</em> Strain S2</td>
            <td>0.0609</td>
            <td>0.0074</td>
        </tr>
        <tr>
            <td>KX856088.1|<em>Rhizobium sp.</em> strain S4</td>
            <td>KX856086.1|<em>Rhizobium sp.</em> Strain S2</td>
            <td>0.128</td>
            <td>0.0108</td>
        </tr>
    </tbody>
</table>
</div>
<p><strong>Table 2:</strong> Estimates of evolutionary distance among members of the same genus.</p>
<div class="well well-sm">
<div class="row">
<div class="col-xs-12 col-md-2"><a onclick="openimage('https://www.omicsonline.org/articles-images/applied-microbiology-evolutionary-genus-3-128-g002.png','','scrollbars=yes,resizable=yes,width=500,height=330')" class="thumbnail"><img src=https://www.omicsonline.org/articles-images/applied-microbiology-evolutionary-genus-3-128-g002.png" class="img-responsive" alt="applied-microbiology-evolutionary-genus" title="applied-microbiology-evolutionary-genus" /></a></div>
<div class="col-xs-12 col-md-10">
<p><strong>Figure 2:</strong> Overall evolutionary distances among members of the         same genus.</p>
</div>
</div>
</div>
<h4>Discussion</h4>
<p><strong>Genetic diversity and distribution of nodule associated   bacteria</strong></p>
<p>This result supports other studies that found more than one species   of rhizobacteria in the nodules of various leguminous plants. Stajkovi?   et al. [<a href="#37" title="37">37</a>] reported the isolation of 115 bacterial strains from 15   nodules, of which almost 60% were rhizobia while the rest belonged to   several other genera. According to the results reported by Rajendran et   al. [<a href="#19" title="19">19</a>] about 10% of the surface sterilized nodules tested showed the   presence of endophytic nonrhizobial flora and some nodules showed   more than one morphologically distinct nonrhizobial colonies.   Kuklinsky-Sobral et al. [<a href="#38" title="38">38</a>] who reported the isolation of nodule   endophytes belonged to the genera <em>Phyllobacterium , Sphingomonas,     Rhodopseudomonas, Pseudomonas, Microbacterium, Mycobacterium,</em> and <em>Bacillus</em> from soya bean nodules. Costa et al. [<a href="#39" title="39">39</a>] isolated the   genera A<em>gromyces, Bacillus, Brevibacillus, Delfitia, Dietzia,     Enterobacter, Methylobacterium, Microbacterium, Micrococcus</em>,<em>Paenibacillus, Pseudomonas, Rhizobium, Rhodococcus,       Sphingobacterium , </em>and<em> Stenotrophomonas</em> from <em>Phaseolus vulgaris</em> .   Probably all the organisms whose presence has a beneficial relation   might get associated with the plant nodules.</p>
<p>Pseudomonas sp. was distributed in the whole of Western Kenya   region because it was isolated from all the nodule samples of common   beans collected from the slopes of Mt. Elgon, shores of Lake Victoria at   Kisumu and Kakamega, Its population was high in nodules from the   common beans grown in Kakamega. This is an indication that it's the   best-adapted nodule associated bacteria in this region. Owing to its   importance as plant growth promoting bacteria [<a href="#40" title="40">40</a>], more sensitive   characterization techniques are required to determine the type of   species found in Western Kenya. <em>Rhizobia</em> sp. was isolated from the   common beans grown on the slopes of Mt. Elgon and shores of Lake   Victoria at Kisumu, but it was not isolated from those from Kakamega.   Although there were very few plants with nodules from this region,   nodulation has always been believed to be the reserve of rhizobia   [<a href="#41">41</a>,<a href="#42" title="42">42</a>] this, therefore, calls for further studies on all other nodule   associated bacteria with the aim of finding out if other bacteria apart   from rhizobia are also capable of inducing nodulation. The population   of rhizobia was high in Kisumu soils; in fact, it was the most abundant   species of rhizobacteria in Kisumu soils. <em>Enterobacter sp</em>. was isolated   in Kakamega and Mt. Elgon soils but not Kisumu soils and its   population was highest and most abundant in Kakamega soils. <em>Providencia </em>sp. was isolated in Kakamega and Mt. Elgon soils and   abundantly in Mt. Elgon soils. <em>Klebsiella sp</em>. was isolated in Mt. Elgon   and Kakamega soil with similar abundance. <em>Delfitia sp</em>. was isolated   from Kisumu and Kakamega soils and abundantly in Kisumu soils. <em>Sphingobacterium sp</em>. and<em> Acinetobacter sp</em>. was isolated only from   Kisumu soils with similar abundance.</p>
<p>Phylogenetic analysis on the basis of 16SrRNA gene sequences   provided better understanding in the evaluation of genetic diversity of   NAB isolated in this study. The neighbor-joining tree constructed put   the isolates into two main clusters, the second cluster was further   subdivided into six other sub-clusters. Even most isolates in the same   sub-cluster differed in their genetic distances showing that most of the nodule associated bacteria in the soils of Western Kenya are genetically   different.</p>
<p>16SrRNA gene of the isolates was highly conserved but with variable   regions which make it a good marker in studying evolutionary   diversity. This is in tandem with other studies which have shown that   the 16SrRNA gene is efficient in defining the genera because it is   conserved but have variable regions, just enough to determine genetic   diversity in organisms [<a href="#43" title="43">43</a>]. However, it has limitations in identifying   species, due to the possible occurrence of genetic recombination and   horizontal gene transfer resulting in sequence mosaicism [<a href="#44" title="44">44</a>,<a href="#45" title="45">45</a>], and   perhaps this might be the reason why members of different genera   clustered together on the phylogenetic tree. Another limitation of   identifying bacteria based on the analysis of 16SrRNA genes is that   species that are closely related may not always be differentiated   because of the sequence conservation of 16SrRNA gene [<a href="#46" title="46">46</a>]. To   overcome these difficulties, the use of other genes including proteincoding   genes with greater sequence divergence than 16SrRNA genes,   are recommended as alternative genetic markers for identification of   the nodule associated bacteria [<a href="#46" title="46">46</a>].</p>
<h4>Conclusion</h4>
<p>Common bean nodule associated bacteria in Western Kenya soils   are genetically diverse as shown by 16SrRNA phylogenetic analysis.   This might be due to different climatic conditions experienced in the   region. More studies are therefore recommended to determine their   growth promotion ability in order to develop inoculants that are   adapted to this region.</p>
<h4>Declarations</h4>
<p>The authors declare that they have no competing interests.</p>
<h4>Funding</h4>
<p>The project was funded by Interuniversity Council for East   Africa/The Lake Victoria Research initiative and Sweden International   Agency.</p>
<h4>Acknowledgements</h4>
<p>We are grateful to Mr. Peter Nyongesa, Mr. Willy Akanyanya, Mr.   Nicholas Kitungulu and Ms. Anjeline Pamba for the technical   assistance.</p>
<h4>References</h4>
<ol>
    <li id="Reference_Titile_Link" value="1"><a name="1" id="1"></a>Makalle AM, Obando J, Bamutaze Y (2008)<a href="http://www.academicjournals.org/journal/AJEST/article-stat/036E4CC11871" target="_blank"> Effects of land  use practices on livelihoods in the transboundary sub-catchments of the Lake  Victoria Basin. African J Environ Sci Techn 2: 309-317.</a></li>
    <li id="Reference_Titile_Link" value="2"><a name="2" id="2"></a>Kawaka F,  Dida MM, Opala PA, Ombori O, Maingi J, et al. (2014)<a href="http://dx.doi.org/10.1155/2014/258497" target="_blank"> Symbiotic efficiency of  native rhizobia nodulating common bean (Phaseolus vulgaris L.) in soils of  Western Kenya. Intern Schol Res Not 2014.</a></li>
    <li id="Reference_Titile_Link" value="3"><a name="3" id="3"></a>Savci S (2012) An agricultural pollutant: inorganic fertilizer. International  Journal of Environmental Science and Development 3: 73.</li>
    <li id="Reference_Titile_Link" value="4"><a name="4" id="4"></a>Agrawal A, Pandey RS, Sharma B (2010)<a href="http://dx.doi.org/10.4236/jwarp.2010.25050" target="_blank"> Water pollution with  special reference to pesticide contamination in India. J Water Resource Prot 2: 432-448.</a></li>
    <li id="Reference_Titile_Link" value="5"><a name="5" id="5"></a>Osoro NO, Kawaka F, Naluyange V, Ombori O, Muoma JO, et al. (2014)  Effects of water hyacinth (Eichhornia crassipes [mart.] solms) compost on  growth and yield of common beans (Phaseolus vulgaris) in Lake Victoria Basin.  Eur Int J Sc  Tech 3: 173-186.</li>
    <li id="Reference_Titile_Link" value="6"><a name="6" id="6"></a>Kloepper JW, Schroth MN, Miller TD (1980)<a href="http://dx.doi.org/10.1094/Phyto-70-1078" target="_blank"> Effects of  rhizosphere colonization by plant growth-promoting rhizobacteria on potato  plant development and yield. Phytopathology 70: 1078-1082.</a></li>
    <li id="Reference_Titile_Link" value="7"><a name="7" id="7"></a>Chen C, Bauske EM, Musson G, Rodriguezkabana R, Kloepper JW  (1995)<a href="http://www.bashanfoundation.org/kloepper/kloepperassociated.pdf" target="_blank"> Biological control of Fusarium wilt on cotton by use of endophytic  bacteria. Biol Control 5: 83-91.</a></li>
    <li id="Reference_Titile_Link" value="8"><a name="8" id="8"></a>Figueiredo MVB, Martinez CR, Burity HA, Chanway CP (2008)<a href="http://dx.doi.org/10.1007/s11274-007-9591-4" target="_blank"> Plant  growth-promoting rhizobacteria for improving nodulation and nitrogen fixation  in the common bean (Phaseolus vulgaris L.). World J Microbiol Biotechnol 24:  1187-1193.</a></li>
    <li id="Reference_Titile_Link" value="9"><a name="9" id="9"></a>Acu&ntilde;a JJ, Jorquera MA, Mart&iacute;nez OA, Menezes-Blackburn D,  Fern&aacute;ndez MT, et al. (2011)<a href="http://www.scielo.cl/scielo.php?script=sci_arttext&amp;pid=S0718-95162011000300001" target="_blank"> Indole acetic acid and phytase activity produced by  rhizosphere bacilli as affected by pH and metals. J Soil Sci Plant Nutr 11: 1-12. </a></li>
    <li id="Reference_Titile_Link" value="10"><a name="10" id="10"></a>Martyniuk S, Oron J, Martyniuk M (2005)<a href="http://dx.doi.org/10.5586/asbp.2005.012" target="_blank"> Diversity and  numbers of root-nodule bacteria [Rhizobia] in Polish soils. Acta Soc Bot Pol 74:  83-86.</a></li>
    <li id="Reference_Titile_Link" value="11"><a name="11" id="11"></a>Maingi JM, Gitonga NM, Shisanya CA, Hornetz B, Muluvi GM  (2006)<a href="http://www.jarts.info/index.php/jarts/article/view/129" target="_blank"> Population levels of indigenous Bradyrhizobia nodulating promiscuous  soybean in two Kenyan soils of the semi-arid and semi-humid agroecological  zones. J Agr Rural Dev Trop Journal 107: 149-159</a></li>
    <li id="Reference_Titile_Link" value="12"><a name="12" id="12"></a>Mwendaa GM, Karanjac NK, Bogaa H, Kahindib JHP, Muigaia A,  et al. (2011)<a href="http://erepository.uonbi.ac.ke/handle/11295/12120" target="_blank"> Abundance and Diversity of Legume Nodulating Rhizobia in Soils of  Embu District. Tropical and Subtropical Agroecosystems 13: 1-10.</a></li>
    <li id="Reference_Titile_Link" value="13"><a name="13" id="13"></a>Rodr??guez H, Fraga R (1999) Phosphate solubilizing bacteria and  their role in plant growth promotion. Biotechnol Adv 17: 319-339.</li>
    <li id="Reference_Titile_Link" value="14"><a name="14" id="14"></a>Khan AA, Jilani G, Akhtar MS, Naqvi SMS, Rasheed M (2009)<a href="http://agris.fao.org/agris-search/search.do?recordID=PK2009001319" target="_blank"> Phosphorus  solubilizing bacteria: occurrence, mechanisms and their role in crop  production. Res J Agric Biol Sci 1: 48-58.</a></li>
    <li id="Reference_Titile_Link" value="15"><a name="15" id="15"></a>Fraire-Vel&aacute;zquez S, Rodr&iacute;guez-Guerra R, S&aacute;nchez-Calder&oacute;n L  (2011)<a href="http://www.intechopen.com/books/abiotic-stress-response-in-plants-physiological-biochemical-and-genetic-perspectives/abiotic-and-biotic-stress-response-crosstalk-in-plants" target="_blank"> Abiotic and biotic stress response crosstalk in plants. Abiotic Stress  Response in Plants-Physiological, Bioinorganic and Genetic Perspectives 3-26.</a></li>
    <li id="Reference_Titile_Link" value="16"><a name="16" id="16"></a>Beneduzi A, Ambrosini A, Passaglia LM (2012)<a href="http://dx.doi.org/10.1590/S1415-47572012000600020" target="_blank"> Plant  growth-promoting rhizobacteria (PGPR): their potential as antagonists and  biocontrol agents. Genet Mol Biol 35: 1044-1051.</a></li>
    <li id="Reference_Titile_Link" value="17"><a name="17" id="17"></a>Hung PQ, Annapurna K (2004)<a href="http://dx.doi.org/10.1007/s11104-004-6894-1" target="_blank"> Isolation and characterization  of endophytic bacteria in soybean (Glycine sp.). Omonrice 12: 92-101.</a></li>
    <li id="Reference_Titile_Link" value="18"><a name="18" id="18"></a>Wekesa CS, Okun D, Juma K, Shitabule D, Okoth P, et al.  (2016)<a href="http://ir-library.ku.ac.ke/handle/123456789/14898" target="_blank"> Abundance and Symbiotic Potential of Common Bean (Phaseolus vulgaris)  Nodule Associated Bacteria in Western Kenya Soil. MAYFEB Journal of  Agricultural Science 1: 1-9.</a></li>
    <li id="Reference_Titile_Link" value="19"><a name="19" id="19"></a>Rajendran G,  Patel MH, Joshi SJ (2012)<a href="http://dx.doi.org/10.1155/2012/693982" target="_blank"> Isolation and characterization of nodule-associated  Exiguobacterium sp. from the root nodules of Fenugreek (Trigonella  foenum-graecum) and their possible role in plant growth promotion. Int J  Microbiol 2012: 1-8.</a></li>
    <li id="Reference_Titile_Link" value="20"><a name="20" id="20"></a>Hamaoui B, Abbadi J, Burdman S, Rashid A, Sarig S, et al. (2001) Effects  of inoculation with Azospirillum brasilense on chickpeas (Cicer arietinum) and  faba beans (Vicia faba) under different growth conditions. Agronomie 21:  553-560.</li>
    <li id="Reference_Titile_Link" value="21"><a name="21" id="21"></a>Schwartz AR, Ortiz I, Maymon M, Herbold CW, Fujishige NA, et  al. (2013)<a href="http://dx.doi.org/10.3390/agronomy3040595" target="_blank"> Bacillus simplex&mdash;a little known PGPB with anti-fungal  activity&mdash;alters pea legume root architecture and nodule morphology when coinoculated  with Rhizobium leguminosarum bv viciae. Agronomy 3: 595-620.</a></li>
    <li id="Reference_Titile_Link" value="22"><a name="22" id="22"></a>Anyango B, Wilson KJ, Beynon JL, Giller KE (1995) The diversity of  rhizobia nodulating Phaseolus vulgaris L. in two Kenyan soils with contrasting  pHs. Appl Environ Microbiol 61: 4016-4021.</li>
    <li id="Reference_Titile_Link" value="23"><a name="23" id="23"></a>Rastogi G, Sani RK (2011)<a href="https://link.springer.com/chapter/10.1007%2F978-1-4419-7931-5_2" target="_blank"> Molecular techniques to assess  microbial community structure, function, and dynamics in the environment. Microbes  and Microbial Technology 29-57.</a></li>
    <li id="Reference_Titile_Link" value="24"><a name="24" id="24"></a>Olsen GJ, Lane DJ, Giovannoni SJ, Pace NR, Stahl DA (1986)<a href="https://dx.doi.org/10.1146/annurev.mi.40.100186.002005" target="_blank"> Microbial ecology and evolution: a ribosomal RNA approach. Annu Rev Microbiol  40: 337-365.</a></li>
    <li id="Reference_Titile_Link" value="25"><a name="25" id="25"></a>Das AJ, Kumar M, Kumar R (2013)<a href="http://www.isca.in/AGRI_FORESTRY/Archive/v1/i4/4.ISCA-RJAFS-2013-019.php" target="_blank"> Plant growth promoting  rhizobacteria (PGPR): an alternative of inorganic fertilizer for sustainable,  environment friendly agriculture. Res J Agriculture &amp; Forestry Sci 1: 21-23.</a></li>
    <li id="Reference_Titile_Link" value="26"><a name="26" id="26"></a>Issar S, Sharma S, Choudhary DK, Gautam HK, Gaur RK (2012)<a href="http://dx.doi.org/10.4236/ajps.2012.31005" target="_blank"> Molecular characterization of Pseudomonas spp. isolated from root nodules of  various leguminous plants of Shekhawati Region, Rajasthan, India. AJPS 3: 60.</a></li>
    <li id="Reference_Titile_Link" value="27"><a name="27" id="27"></a>Mahbouba B,  Nadir B, Nadia Y, Abdelhamid D (2013)<a href="http://dx.doi.org/10.5897/AJMR12.2028" target="_blank"> Phenotypic and molecular characterization  of plant growth promoting Rhizobacteria isolated from the rhizosphere of wheat  (Triticum durum Desf.) in Algeria. Afr J  Microbiol Res 7: 2893-2904.</a></li>
    <li id="Reference_Titile_Link" value="28"><a name="28" id="28"></a>Vinay O,  Bhupendra P, Kiran S (2013)<a href="http://dx.doi.org/10.5897/AJMR12.2028" target="_blank"> 16S rDNA-RFLP analysis of phylogenetic tree of  Rhizobium bacteria. IJAR 3: 474-476.</a></li>
    <li id="Reference_Titile_Link" value="29"><a name="29" id="29"></a>Liu L, Li Y,  Li S, Hu N, He Y, et al. (2012)<a href="http://dx.doi.org/10.1155/2012/251364" target="_blank"> Comparison of next-generation sequencing  systems. BioMed Res. Int 2012: 1-11.</a></li>
    <li id="Reference_Titile_Link" value="30"><a name="30" id="30"></a>Rinc&oacute;n A, Arenal F, Gonz&aacute;lez I, Manrique E, Lucas MM, et  al. (2008)<a href="https://dx.doi.org/10.1007/s00248-007-9339-6" target="_blank"> Diversity of rhizobial bacteria isolated from nodules of the  gypsophyte Ononis tridentata L. growing in Spanish soils. Microb Ecol 56: 223-233.</a></li>
    <li id="Reference_Titile_Link" value="31"><a name="31" id="31"></a>Hall TA (1999)<a href="http://www.citeulike.org/user/echinotrix/article/691774" target="_blank"> BioEdit: a user-friendly biological sequence alignment editor  and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41: 95-98.</a></li>
    <li id="Reference_Titile_Link" value="32"><a name="32" id="32"></a>Thompson JD,  Higgins DG, Gibson TJ (1994)<a href="https://doi.org/10.1093/nar/22.22.4673" target="_blank"> CLUSTAL W: improving the sensitivity of  progressive multiple sequence alignment through sequence weighting,  position-specific gap penalties, and weight matrix choice. Nucleic Acids Res  22: 4673-4680.</a></li>
    <li id="Reference_Titile_Link" value="33"><a name="33" id="33"></a>Saitou N, Nei M (1987)<a href="https://doi.org/10.1093/oxfordjournals.molbev.a040454" target="_blank"> The neighbor-joining method: A new  method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406-425.</a></li>
    <li id="Reference_Titile_Link" value="34"><a name="34" id="34"></a>Felsenstein J  (1985)<a href="http://dx.doi.org/10.2307/2408678" target="_blank"> Confidence limits on phylogenies: An approach using the bootstrap.  Evolution 39: 783-791.</a></li>
    <li id="Reference_Titile_Link" value="35"><a name="35" id="35"></a>Jukes TH, Cantor CR (1969)<a href="http://garfield.library.upenn.edu/classics1990/A1990CZ67100002.pdf" target="_blank"> Evolution of protein molecules.  In Munro HN, editor, Mammalian Protein Metabolism 21-132.</a></li>
    <li id="Reference_Titile_Link" value="36"><a name="36" id="36"></a>Tamura K, Stecher G, Peterson D, Filipski A, Kumar S  (2013)<a href="https://dx.doi.org/10.1093/molbev/mst197" target="_blank"> MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol  Evol 30: 2725-2729.</a></li>
    <li id="Reference_Titile_Link" value="37"><a name="37" id="37"></a>Stajkovi? O, Deli? D, Jo&scaron;i? D, Kuzmanovi? ?, Rasuli? N, et  al. (2011)<a href="http://www.rombio.eu/rbl1vol16/11%20Stajkovic.pdf" target="_blank"> Improvement of common bean growth by co-inoculation with Rhizobium  and plant growth-promoting bacteria. Rom Biotechnol Lett 16: 5919-5926.</a></li>
    <li id="Reference_Titile_Link" value="38"><a name="38" id="38"></a>Kuklinsky-Sobral J, Araujo WL, Mendes R, Pizzirani-Kleiner  AA, Azevedo JL (2005)<a href="http://dx.doi.org/10.1007/s11104-004-6894-1" target="_blank"> Isolation and characterization of endophytic bacteria  from soybean (Glycine max) grown in soil treated with glyphosate herbicide.  Plant Soil 273: 91-99.</a></li>
    <li id="Reference_Titile_Link" value="39"><a name="39" id="39"></a>Costa LEDO, Queiroz MVD, Borges AC, Moraes CAD, et al.  (2012)<a href="https://dx.doi.org/10.1590/S1517-838220120004000041" target="_blank"> Isolation and characterization of endophytic bacteria isolated from the  leaves of the common bean (Phaseolus vulgaris). Braz J Microbiol 43: 1562-1575.</a></li>
    <li id="Reference_Titile_Link" value="40"><a name="40" id="40"></a>Yadegari M (2014)<a href="https://www.researchgate.net/publication/286036638_Inoculation_of_bean_Phaseolus_vulgaris_Seeds_with_Rhizobium_phaseoli_and_plant_growth_promoting_Rhizobacteria" target="_blank"> Inoculation of bean (Phaseolus vulgaris)  seeds with Rhizobium phaseoli and plant growth promoting Rhizobacteria. Adv  Environ Biol 419-425.</a></li>
    <li id="Reference_Titile_Link" value="41"><a name="41" id="41"></a>Fonseca MB, Peix A, de Faria SM, Mateos PF, Rivera LP, et  al. (2012)<a href="http://dx.doi.org/10.1371/journal.pone.0049520" target="_blank"> Nodulation in Dimorphandra  wilsonii Rizz. (Caesalpinioideae), a threatened species native to the Brazilian  Cerrado. PloS one 7: e49520.</a></li>
    <li id="Reference_Titile_Link" value="42"><a name="42" id="42"></a>Denison RF (2000)<a href="https://pdfs.semanticscholar.org/ddd5/93d27e901543e2db0f105cc6aeaf0ccd73dd.pdf" target="_blank"> Legume sanctions and the evolution of  symbiotic cooperation by rhizobia. Am Nat 156: 567-576.</a></li>
    <li id="Reference_Titile_Link" value="43"><a name="43" id="43"></a>Silva FV, Sim&otilde;es-Ara&uacute;jo JL, Silva J&uacute;nior JP, Xavier GR,  Rumjanek NG (2012)<a href="https://dx.doi.org/10.1590%2FS1517-83822012000200033" target="_blank"> Genetic diversity of Rhizobia isolates from Amazon soils  using cowpea (Vigna unguiculata) as the trap plant. Braz J Microbiol 43:  682-691.</a></li>
    <li id="Reference_Titile_Link" value="44"><a name="44" id="44"></a>Munns DN, Keyser HH (1981)<a href="http://dx.doi.org/10.1016/0038-0717(81)90006-7" target="_blank"> Response of Rhizobium strains  to acid and aluminium stress. Soil Biol Biochem 13: 115-118.</a></li>
    <li id="Reference_Titile_Link" value="45"><a name="45" id="45"></a>Ntushelo K (2013)<a href="http://dx.doi.org/10.5897/AJMR2013.5966" target="_blank"> Identifying bacteria and studying  bacterial diversity using the 16S ribosomal RNA gene-based sequencing  techniques: A review. Afr J Microbiol Res 7: 5533-5540.</a></li>
    <li id="Reference_Titile_Link" value="46"><a name="46" id="46"></a>Martens M, Delaere M, Coopman R, De Vos P, Gillis M, et  al. (2007)<a href="https://dx.doi.org/10.1099/ijs.0.64344-0" target="_blank"> Multilocus sequence analysis of Ensifer and related taxa. Int J Syst  Evol  Microbiol 57: 489-503.</a></li>
    <li id="Reference_Titile_Link" value="47"><a name="47" id="47"></a>Peters JB, Laboski CA, Bundy LG (2007)<a href="http://www.americasalfalfa.com/alfalfa/media/Images/UW-Soil-Sampling-A2100.pdf" target="_blank"> Sampling soils for  testing. Division of Cooperative Extension of the University of Wisconsin&mdash;Extension  2100.</a></li>
</ol>

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Article Usage

  • Total views: 506
  • [From(publication date):
    March-2017 - Jun 25, 2018]
  • Breakdown by view type
  • HTML page views : 454
  • PDF downloads : 52
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

+1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
Leave Your Message 24x7