alexa The Spleen Contributes Stem Cells to Peripheral Blood Stem Cell Transplants | OMICS International
ISSN: 2157-7633
Journal of Stem Cell Research & Therapy
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

The Spleen Contributes Stem Cells to Peripheral Blood Stem Cell Transplants

Toshiyuki Mera1, Shelly Heimfeld2 and Denise L Faustman1*

1Department of Medicine, Harvard Medical School and Massachusetts General Hospital, Boston, Massachusetts, USA

2Department of Medicine, Immunobiology Laboratories and Boston, Massachusetts, Fred Hutchinson Cancer Research Center, Clinical Research Division, Seattle,Washington, USA

*Corresponding Author:
Denise L Faustman
Harvard Medical School and Massachusetts General Hospita
Boston, Massachusetts, USA
Tel: 617-726-4084
Fax: 617-726-4095
E-mail: [email protected]

Received date: November 07, 2014; Accepted date: December 08, 2014; Published date: December 10, 2014

Citation: Mera T, Heimfeld S, Faustman DL (2014) The Spleen Contributes Stem Cells to Peripheral Blood Stem Cell Transplants. J Stem Cell Res Ther 4:253. doi:10.4172/2157-7633.1000253

Copyright: © 2014 Mera T, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Stem Cell Research & Therapy


Treatment of malignancies with Peripheral Blood Stem Cell Transplants (PBSCTs) from donors given Granulocyte- Colony-Stimulating-Factor (G-CSF) has improved survival relative to bone marrow transplants. G-CSF mobilizes CD34+ hematopoietic stem cells from bone marrow into the blood. Enrichment of PBSCT by purification of CD34+ stem cells fails to produce superior clinical benefits. We hypothesize that the reason why CD34+-enriched PBSCTs are not more effective is because the enrichment and purification process leaves out G-CSF-mobilized stem cells from another source, the spleen, which holds a unique reservoir of Hox11+ stem cells. Quantitative mRNA analysis was used to determine whether G-CSF mobilizes Hox11+ stem cells and whether expression occurs in a cell population distinct from CD34+ cells. Samples of peripheral blood lymphocytes (PBLs) were obtained from ten normal untreated donors and 18 normal donors treated with G-CSF. G-CSF was found to mobilize both CD34+ stem cells (p=0.02) and even more dramatically mobilize Hox11+ splenic stem cells (p=0.000013) into the peripheral blood. The findings support the hypothesis that G-CSF mobilizes two distinct stem cell populations, one from the bone marrow and the other from the spleen. The inferior clinical performance of CD34+-enriched and purified PBSCTs compared to unenriched PBSCTs may be explained by the omission of Hox11+ stem cells. These findings suggest that PBSCTs without enrichment and purification of CD34+ may improve treatment of cancer and potentially other diseases in tissues derived from Hox11+ stem cells.


Bone marrow transplantation; Granulocyte-Colony Stimulating Factor (G-CSF); Peripheral Blood Stem Cell Transplants (PBSCT); Peripheral Blood Lymphocytes (PBLs); CD34; Hox11 (Tlx1); Graft Versus Host Disease (GVHD)


Treatment of malignancies with allogeneic peripheral blood stem cell transplants (PBSCTs) from donors given granulocyte-colonystimulating- factor (G-CSF) has decreased relapse rates and improved or maintained survival compared to bone marrow transplants, although graft versus host disease (GVHD) still occurs [1]. For autologous stem cell transplants, the use of autologous PBSCT from G-CSF stimulation also in multiple studies shows faster recovery of neutrophils and platelets, and fewer days to transfusion independence but with no differences in survival [2-5]. G-CSF mobilizes CD34+ hematopoietic stem cells from bone marrow into the blood. Further enrichment of PBSCT by purification of CD34+stem cells does not generate superior clinical benefits and in some cases shows slower white blood cell recovery with increased infections due to poor immune reconstitution [6,7]. We hypothesize that the reason why CD34+-enriched PBSCT are not more effective is because the enrichment process leaves out G-CSF-mobilized stem cells from another source, the spleen.

The adult spleen harbors throughout life stem cells expressing the Hox 11 oncogene, also known as Tlx1 [8]. Adult human bone marrow lacks Hox 11 stem cells [8]. Hox 11 is an embryonic transcription factor not found in bone marrow but persistse throughout life in the adult human spleen. Hox 11 was first identified in association with cancers including T cell acute lymphocytic leukemia but more recent research shows all humans harbor Hox11 expressing stem cells in their spleen throughout their life [8,9].

Hox 11 plays an important role in development of cell differentiation during which it activates a cascade of genes controlling cell fate and cell differentiation. In various human and animal models, Hox 11+ stem cells robustly differentiate into functional cells of multiple lineages, including cranial neurons, hematopoietic cells, pancreatic islets, bone and salivary glands [10]. The spleen also uniquely contributes to complete B cell memory [11]. The stem cells of the spleen allow for full maturation of immature transitional B cells into naive B cells. The later step is unique to splenic function since splenectomy results in similar accumulations of naïve B cells, reduction of memory B cells and well-known susceptibilities to select infections [12]. Interestingly, this immature peripheral phenotype was similar to bone marrow transplants before G-CSF. Our hypothesis about a splenic stem cell contribution to PBSCT also derives from the observation that G-CSF mobilizations induce splenomegaly in most donors and in rare, severe cases splenic rupture [13,14]. Splenomegaly might reflect dramatic G-CSF-induced Hox11+ stem cell proliferation. We examine by quantitative mRNA analysis whether G-CSF mobilizes Hox11+ stem cells and whether expression occurs in a cell population distinct from CD34+ cells. We need only assay for Hox11+ and CD34+ transcripts because these markers are unique to splenic and bone marrow stem cells, respectively [15,16]. Published data of the complete and unique proteomic signature of adult Hox11 stems has been reported [16].

Materials and Methods


Human peripheral blood lymphocytes (PBLs) used for this study were from the Core Center of Excellence in Hematology (CCEH) at the Fred-Hutchison-Cancer-Research Center or Massachusetts General Hospital (MGH) (FHRC-985.03C/MGH-2001P001379).


We extracted total RNA from PBLs from G-CSF treated or nontreated donors using the RNeasy Mini kit (QIAGEN). The generated cDNA with the High Capacity cDNA Reverse Transcription Kit allowed quantitative real-time PCR using Power SYBR-Green and 7000 Real- Time-PCR (Applied Biosystems). PBLs and the Beta-Actin housekeeper gene were used to normalize data and relative expression was calculated using the ddCT method. HOX11/TLX1 (GeneID; 3195) specific primers were forward sequence:5’-GGTTCACAGGTCACCCCTATC -3’ and reverse sequence: 5’- GTCTGCCGTCTCCACTTTGTC - 3’. The beta-actin (Gene ID;60) primers were forward sequence: 5’-CATGTACGTTGCTATCCAGGC and reverse sequence:5’- CTCCTTAATGTCACGCACGAT-3’. The CD34 (Gene ID;947) primers were forward sequence:5'-CTACAACACCTAGTACCCTTGGA-3', reverse sequence:5'- GGTGAACACTGTGCTGATTACA-3'. All primers were purchased from Custom DNA Oligos (Invitrogen). The ALL-SIL cell line (DSMZ) that expresses HOX11/TLX1 was a positive control for the TLX1 primers.

Statistical analysis

All data analysis to determine the statistical significance was calculated using an unpaired t-test. Statistical significance was viewed as a p value<0.05. Calculations were performed in GraphPad Prism-5 software.


Ten normal human donors provided untreated samples of peripheral blood lymphocytes (PBLs) and 18 donors provided samples of G-CSF-mobilized PBLs. G-CSF mobilized into the blood circulation both CD34+ bone derived stem cells (p=0.02) and Hox11+ derived splenic stem cells (p=0.000013) compared with non-mobilized PBLs (Figure 1). The relative increase of mobilized Hox11-derived splenic stem cells was very large in comparison to the CD34 stem cells (Figure 1). To rule out the possibility that Hox11 is co-expressed on CD34+ cells after G-CSF treatment, we examined G-CSF-mobilized unmanipulated and CD34+-enriched samples (Figure 2). We found that the enrichment process only resulted in dramatically increased CD34+ expression (p<0.0001); these enriched cells do not express Hox11+ (P<0.02) (Figure 2). Therefore G-CSF mobilizes two non-overlapping populations of stem cells.


Figure 1: CD34+ and HOX11+ mRNA expression in peripheral blood lymphocytes (PBLs) from normal untreated donors (n=10) versus C-GSF-mobilized donors (n=18). G-CSF mobilizes both Hox11 and CD34+ stem cells into the circulation. (a) The left panel shows CD34+mRNA representing the means ± minus the standard errors of the means of the pooled samples. The right panel shows Hox11+mRNA representing the means ± minus the standard errors of the means of the pooled samples. (b) The left and right panels represent the individual data points of the subjects used for the pooled data in A.


Figure 2: The effect of CD34+ enrichment of G-CSF-mobilized PBLs on the expression of CD34 or Hox11. Bone marrow-derived CD34+ stem cells are a distinct stem cell population from splenic derived Hox11+ stem cells (a) The left panel shows CD34+mRNA means plus ± minus the standard errors of the means of the pooled samples. The right panel shows Hox11+ mRNA means plus ± minus the standard errors of the means of the pooled samples. (b) The left and right panels display the individual data points of the single subject samples used for the pooled data in A. n=18 samples from normal G-CSF-treated donors. n= 4 samples for the mobilized and CD34+-enriched samples from G-CSF treated donors.


Our findings support the hypothesis that G-CSF mobilizes at least two distinct and non-overlapping populations of stem cells, CD34+ hematopoietic stem cells from bone marrow and Hox11+ stem cells from the spleen. The very dramatic mobilization of splenic stem cells suggests that G-CSF’s well-known advantage over bone marrow for stem cell transplantation protocols may be due to two stem cell populations, including the less differentiated stem cells of the spleen with broad hematopoietic reconstitution abilities [9,11,12,16,17]. Indeed, prior to this data it was viewed that the common occurrence of splenomegaly after G-CSF treatment was an adverse outcome that could on rare occasions result in splenic rupture; instead it may well be the case the G-CSF is mobilizing immature stem cells, mature neutrophils and other beneficial splenic populations [18-20]. Since Hox11 splenic stem cells are known to have multi-lineage potential, represent the embryonic precursor to bone marrow stem cells and in adults also contain unique B cell populations for fighting infections and complete B cell memory, our findings may help clinicians improve PBSCTs for the treatment of cancer and potentially other diseases [21-23].


We are indebted to The Iacocca Foundation for their support of this project. Dr. Miriam Davis of our group contributed to the proof reading of this paper and Ms. Lynne Murphy provided manuscript preparation assistance.


Figures at a glance

Figure Figure
Figure 1 Figure 2
Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

  • 20th Global Congress on Biotechnology March 5-7, 2018 London, UK
    March 5-7, 2018 London, UK
  • 7th International Conference and Exhibition on Cell and Gene Therapy March 15-16, 2018 London,UK
    March 15-16, 2018 London, UK
  • 10th World Congress and Expo on Cell & Stem Cell Research March 19-21, 2018 New York, USA
    March 19-21, 2018 New York, USA
  • 4th World Congress on Human Genetics and Genetic Diseases April 19-20, 2018 Dubai, UAE
    April 19-20, 2018 Dubai, UAE
  • 3rd International Conference on Molecular Medicine and Diagnostics April 19-20, 2018 Dubai,UAE
    April 19-20, 2018 Dubai, UAE
  • 11th World Congress on Cell & Tissue Science May 09-10, 2018 Tokyo, Japan
    July 19-20, 2018 Dubai, UAE
  • 11th World Congress on Cell & Tissue Science May 09-10, 2018 Tokyo, Japan
    May 09-10, 2018 Tokyo, Japan
  • 6th International Conference on Integrative Biology May 21-23, 2018 Barcelona, Spain
    May 21-23, 2018 Barcelona, Spain
  • 10th International Conference on Genomics and Molecular Biology May 21-23, 2018 Barcelona, Spain
    May 21-23, 2018 Barcelona, Spain
  • 12th Annual Conference on Stem Cell and Regenerative Medicine June 04-06, 2018 Prague, Czech Republic
    June 04-06, 2018 Prague, Czech Republic
  • 4th International Conference on Bioscience July 2-3, 2018 Vienna, Austria
    July 2-3, 2018 Vienna, Austria
  • 22nd World Congress on Biotechnology July 10-11, 2018 Bangkok, Thailand
    April 16-18, 2018 Amsterdam, Netherlands
  • 9th International Conference on Tissue Science and Regenerative Medicine July 13-14, 2018 Sydney, Australia
    April 23-24, 2018 Las Vegas, USA
  • 10th Annual Conference on Stem Cell and Regenerative Medicine August 13-14, 2018 London, UK
    August 13-14, 2018 London, UK
  • World Congress on Stem Cell Biology and Biobanking September 3-4, 2018 Tokyo, Japan
    September 3-4, 2018 Tokyo, Japan
  • 2nd Annual summit on Cell Metabolism and Cytopathology September 19 - 20, 2018 Philadelphia, Pennsylvania, USA
    September 19 - 20, 2018 Philadelphia, USA
  • 2nd Annual summit on Cell Signaling and Cancer Therapy September 19 - 20, 2018 Philadelphia, Pennsylvania, USA
    September 19 - 20, 2018 Philadelphia, USA
  • 6th Annual Congress on Biology and Medicine of Molecules September 20-21,2018 Kuala Lumpur, Malaysia
    September 20-21,2018 Kualalumpur, Malaysia
  • 5th International Conference on Human Genetics and Genetic Disorders September 21-22,2018 Philadelphia, Pennsylvania, USA
    September 21-22,2018 Philadelphia, USA
  • 11th International Conference on Genomics and Pharmacogenomics September 21-22, 2018 Philadelphia, Pennsylvania, USA
    September 21-22, 2018 Philadelphia, USA
  • 5th World Congress on HUMAN GENETICS SEPTEMBER 24-25, 2018 BERLIN, GERMANY
    SEPTEMBER 24-25, 2018 Berlin, Germany
  • 21st Euro Biotechnology Congress October 11-12, 2018 Moscow, Russia
    October 11-12, 2018 Moscow, Russia
  • 11th International Conference on Tissue Engineering & Regenerative Medicine October 18-20, 2018 Rome, Italy
    October 18-20, 2018 Rome, Italy
  • 24th Biotechnology Congress: Research & Innovations October 24-25, 2018 Boston, USA
    October 24-25, 2018 Boston, USA
  • International Conference on Human Genome Meeting October 25-26, 2018 Istanbul, Turkey
    October 25-26, 2018 Istanbul, Turkey
  • International Congress & Expo on Genomics and Bioinformatics November 2-3, 2018 Columbus, Ohio, USA
    November 2-3, 2018 Columbus, USA
  • 12th International Conference & Exhibition on Tissue Preservation and Biobanking November 9-10, 2018 Atlanta, Georgia, USA
    November 9-10, 2018 Atlanta, USA
  • 2nd Annual Summit on Cell Therapy and Stem Cell Research November 9-10, 2018 Atlanta, Georgia, USA
    November 9-10, 2018 Atlanta, USA

Article Usage

  • Total views: 11978
  • [From(publication date):
    December-2014 - Jan 19, 2018]
  • Breakdown by view type
  • HTML page views : 8181
  • PDF downloads : 3797

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals


[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version