alexa The Stature of Human Thyroid Cancer Related to Over Expressed mir-221 and mir-146b | Open Access Journals
ISSN-2155-9929
Journal of Molecular Biomarkers & Diagnosis
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

The Stature of Human Thyroid Cancer Related to Over Expressed mir-221 and mir-146b

Jamshid Molaei, Melika Meidanchi and Sina Mirzaahmadi*

Department of the Genetics, Zanjan branch, Islamic Azad University, Zanjan, Iran

*Corresponding Author:
Sina Mirzaahmadi
Department of the Genetics, Zanjan branch
Islamic Azad University, Zanjan, Iran
Tel: 44865179-82, 44865154-8
E-mail: sinacanmir@yahoo.com

Received Date: Novembert 07, 2016; Accepted Date: January 22, 2017; Published Date: January 24, 2017

Citation: Molaei J, Meidanchi M, Mirzaahmadi S (2017) The Stature of Human Thyroid Cancer Related to Over Expressed mir-221 and mir-146b. J Mol Biomark Diagn S2: 030. doi:10.4172/2155-9929.S2-030

Copyright: © 2017 Molaei J, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Visit for more related articles at Journal of Molecular Biomarkers & Diagnosis

Abstract

Purpose: The ability of miRNAs for biomarker tools was further built by recent research showing that cancerspecific miRNAs are traceable in cell-free blood fluids such as plasma and serum. In this study, the levels of miR-221 and miR146b in human’s peripheral blood as tumor markers for early detection of Papillary Thyroid Carcinoma [PTC] were investigated.

Methods: A stem-loop quantitative reverse transcription-polymerase chain reaction [qRT-PCR] method was performed to determine the serum levels of miR-221 and miR-146b from 25 healthy controls, 25 PTC patients the day before thyroidectomy, 25 patients with benign nodules and 25 patients after thyroidectomy during the scheduled medical examinations.

Results: There was statistical difference in the serum levels for miR-221 and miR-146b between the controls and the PTC patients. It also showed no statistical difference for miR-221 and miR-146b between controls and thyroidectomy patients.

Conclusion: The overexpression of miR-221 and miR-146b could be potentially served as serum indicator biomarkers in the approach for Thyroid Papillary Carcinoma detection from benign nodules.

Keywords

microRNAs; Papillary Thyroid Carcinoma [PTC]; qRT-PCR; Biomarkers

Introduction

Thyroid nodules are a very frequent pathology among common population. Despite the vast majority of them are of benign origin, the incidence of thyroid cancer is currently rather rising [1]. Papillary thyroid carcinoma (PTC) is the most common form of thyroid cancer, comprising about 85% of all thyroid cancer [2]. Fine needle aspiration (FNA) biopsy is the gold standard for diagnosing thyroid nodules. However, 10% to 15% of these biopsies are inconclusive, ultimately requiring a diagnostic thyroid lobectomy [3]. FNA is an invasive diagnostic method and heavily dependent on the technical performance and experience of the operators. Thus, considerable effort has been made to identify other reliable markers for primary PTC [4]. Several types of ancillary approaches have been used to improve the diagnostic yield of FNA biopsies in determinate thyroid nodules. These include immuno-histochemical stains, microRNAs, gene mutations/ rearrangements, and gene expression panels [5]. MicroRNAs (miRNAs) are 22- to 25-nucleotide non-coding RNA molecules that typically prohibit protein production by binding to the 3’ untranslated region [UTR] of specific target mRNAs [6]. Each microRNA has the distinct capability to potentially regulate the expression of hundreds of coding genes and thereby modulate several cellular pathways including proliferation, apoptosis and stress response [7]. In addition to their roles in normal physiology, miRNAs are frequently dysregulated in cancer. This paradigm suggests that miRNAs could be clinically useful cancer biomarkers. The potential of miRNAs for biomarker applications was further reinforced by recent research showing that cancer-specific miRNAs are detectable in cell-free blood fluids such as serum and plasma [8]. Searching literature for published studies to identify which miRNAs altered expression has related to PTC, revealed that PTC has associated with MiR-221 and MiR-146b over expression [9]. MiR-221 is among the most frequently up-regulated miRNAs in human cancer. It is over-expressed in a large fraction of glioblastoma, liver, bladder, and thyroid, pancreatic, gastric, and prostate carcinomas [10]. The miR221-222 cluster is located on the X chromosome. They are involved in the regulation of cell cycle and apoptosis. They are well known for their deregulations in various malignancies and are among the first group of miRNAs shown to be deregulated in thyroid cancer [9]. It has been observed that there is an inverse correlation between the expression of miR-221 and some cell cycle inhibitors, such as CDKN1C/ p57 [CDKI] [11]. The cyclin-dependent kinase inhibitor CDKN1B/p27 is also a direct target of miR-221 [12]. In fact, decreased expression of both CDKN1C/p57 and CDKN1B/p27 happens in response to miR- 221 transfection and a significant over expression of both CDKN1C/ p57 and CDKN1B/p27 happens in response to anti-miR-221 transfection [13]. MiR-221 is up-regulated [5-fold] in PTC, which leads to reduction in the protein level of p27 [Kip1] in PTC tumors [14]. MiR-146b is currently one of the most studied miRNAs in PTC. MiR- 146b appears to be a prognostic factor for PTC, as it is associated with aggressive clinicopathological features and a poor clinical outcome [15]. In one study, miR-146b was the most consistently overexpressed miRNA in PTC. Two genetic loci, one on chromosome 5q33 and one on chromosome 10q24, encode miR-146a and miR-146b, respectively. These two loci differ by only two nucleotides. The expression profiles of miR-146a and miR-146b are both upregulated in PTCs. In several PTC samples, miR-146b was more highly expressed than miR-146a, and its increased expression was associated with greater aggressiveness of thyroid tumours [16]. In the present study, we revealed that miR-221 and miR-146b expression were significantly overexpressed in serum samples of PTC in comparison with controls and the benign nodules and thyroidectomy patients, which could be serve as novel biomarkers for early detection of Papillary Thyroid Carcinoma.

Materials and Methods

Human serum samples

The Shariaty Hospital collected biological samples and clinical data from patients. All patients gave written consent for sample and ongoing data collection, and practices and procedures were approved by the Shariaty Human Research Ethics Committees [Ref. No. IR.TUMS. EMRI.REC.1394.0037]. The 4 groups were selected for sampling. The sample size was estimated in each group 25 members, based on the following equation.

Equation 1:

molecular-biomarkers-diagnosis

Which α=0.05 and β=0.2 and μ1=1.38 and μ2=0.64, δ1=0.97 and δ2=0.42 [17]. Peripheral blood was collected in EDTA anticoagulation tubes from 25 healthy controls, 25 PTC patients the day before thyroidectomy, 25 patients with benign nodules and 25 patients after surgery during the scheduled medical examinations. None of the controls had previously been diagnosed with a thyroid malignancy.

Extraction of total RNA from the serum

The total RNA including small RNAs were extracted from 100 μl of the blood serum according to the manufacturer’s instructions by using the miTotalTM RNA Extraction Miniprep System Kit [Cat.NO. VTR1001, Viogene BioTek Corp.]. RNA quality was measured with the Thermo Scientific NanoDrop Lite Spectrophotometer (ND-Lite spectrophotometer; Thermo Fisher Scientific, Inc., Wilmington, DE, USA). The quantity of total RNA isolated was from 50-100 ng/μl. The eluted RNA stored at -70°C.

Stem-loop qRT-PCR assay design

In this study, it was used a stem-loop qRT-PCR procedure to quantify the expression of the miR-221 and miR-146b. Glyceraldehyde- 3-phosphate dehydrogenase [GAPDH] is one of the most common internal control genes and is mostly used to evaluate gene expression data [18]. Small RNA specific stem-loop was designed based on stemloop quantitative PCR assay design free software (http://genomics. dote.hu:8080/mirnadesigntool/). Mature small RNA sequences used to design the qRT-PCR assays and the designed oligonucleotides used in this study are listed in Table 1 [19].

Name Sequence, 5'-3'
RT Universal stem-loop primer
miR-221 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAAACCC
  miR-146b GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGA TACGACCCAGAAC
qRT-PCR primers
miR-221 F, GCGAGCTACATTGTCTGCTGGGTTT; and
R, GTGCAGGGTCCGAGGT
miR-146b F, TGCCCTGTGGACTCAGT; and
R, GTGCAGGGTCCGAGGT
GAPDH F, GGTCATCATCTCTGCCCCCT; and
R, AGGCAGGGATGATGTTCTGG

Table 1: Primers for RT or amplification of the mature miR‑221, miR-146b and GAPDH mRNA.

Reverse transcription with miRNA-specific stem-loop primers

Almost 0.5μg total RNA was used to perform reverse transcription of RNA with the CinnaGen First Strand cDNA synthesis Kit [Cat. No. RT5209]. First 1μM miRNA-specific stem-loop primer was added to total RNA and incubated at 65°C for 5 min and then snapped on ice for 2 min. So the total RNA got denatured. A mixture of 2X Buffer M-MuLV, 2U M-MuLV Reverse Transcriptase and 1mM dNTPs was mixed with the denatured RNA product and volume was brought to 20 μl with RNase-Free water. The RT reaction was performed in a total volume of 20 μl at 42°C for 60 min, then the enzymes were deactivated at 85°C for 5 min and finally the RT product were produced. Meanwhile, the negative controls with no template (NTC) were included in RT reaction, separately.

Quantification of the miR-221, miR-146b and GAPDH expression by qRT-PCR

Real-time PCR was performed with Roto-Gene 2000 [Corbett Research, Australia] in a total volume of 20 μl per reaction in triplicate. We placed 2 μl of RT product described previously into an 18 μl reaction mixture that contained 1X SYBR Green Master mix [PARSGENOME MiR-Amp kit], 2μM primer mix of the forward primers and the reverse primers, 2 μl cDNA product as a 10% of total volume of PCR reaction brought top up to 20 μl with diethyl pyro carbonate [DEPC] H2O. The cycling protocol consisted of three steps: first, an initial denaturation, 5 min at 95°C to deactivating the RT enzyme; second, 40 cycles of denaturation at 95°C for 5 s, annealing 63°C for 20 s and extension at 72°C for 30 s, and the third, Plate-reading of fluorescence signals, meltcurve analysis from 70 to 90°C. Real-time PCR for GAPDH gene was performed in the same manner, by using the corresponding primers.

Statistical Analysis

In our study, quantization was achieved using the comparative CT and Pfaffl method, normalization versus the GAPDH gene as a house keeping gene.

Comparative CT

The expression level of miR-221, miR-146b in comparative to the GAPDH were assessed using the 2-ΔΔCt method. Briefly, the CT of fluorescence was determined for each sample [20]. ΔCT indicates the difference in expression levels between miR-221, miR-146b and GAPDH [ΔCT = CT miR-221 - CT GAPDH], [CT = CT miR-146b - CT GAPDH], and ΔΔCT indicates the difference in the ΔCT value between the control/normal and for example the PTC [ΔΔCT = ΔCT control - ΔCT PTC]. The 2-ΔΔCt value [fold-value] was calculated.

Pfaffl method

To identify the most significant differentially expressed miR-221, miR-146b between samples and control, we performed a supervised analysis by Relative expression software tool [REST], proposed by Pfaffl et al. [21], which compares two groups, with up to 16 data points in the sample group versus 16 data points in the control group, and tests the group differences for significance with a newly developed randomization test [22]. The relative expression ratio of a target gene is computed, based on its real-time PCR efficiencies [E] and the crossing point [CP] difference [Δ] of an unknown sample versus a control [ΔCP control – sample]. In mathematical models the target gene expression is normalized by a non-regulated reference gene expression, e.g. derived from housekeeping genes [GAPDH].

Equation 2:

molecular-biomarkers-diagnosis

Equation 2 shows a mathematical model of relative expression ratio in real-time PCR. The ratio of miR-221,146b gene is expressed in a sample versus a control in comparison to GAPDH gene.

Results

Serum miR-221 in PTC

Alteration of miR-221 expression level relative to the reference GAPDH in healthy controls, PTC patients, patients with benign nodules and patients after thyroidectomy were assessed (Table 2).

Sample GAPDH CT miR-221 CT ΔCT (Avg. GAPDH – Avg. miR221) ΔΔCT (Avg. ΔCT
Avg. ΔCT control)
Normalized miR-221 expression
relative to control 2-ΔΔCT
Control 30.83 27.70 3.12 - 1.00
PTC 31.75 17.26 14.49 -11.36 2,635.75
Benign nodule 30.62 26.10 4.52 -1.39 2.63
Thyroidectomy 30.79 28.08 2.70 0.42 0.75
  Sum of Squares df Mean Square F Sig.
Between Groups 2330.507 3 776.836 163.242 0.000
Within Groups 456.844 96 4.759    
Total 2787.351 99      

Table 2: Alteration of miR-221 expression level relative to the GAPDH.

Data were analyzed with SPSS software, version 12.0 (SPSS Inc., Chicago, IL, USA) and Excel software (Microsoft, Redmond, USA). One-way ANOVA and Bonferroni tests were used to investigate the association between controls and other types. P<0.001 was considered to indicate a statistically significant difference.

The mean (±SD) ΔCT value was 14.491 ± 3.259 in the 25 samples from patients with PTC and 3.127 ± 2.220 in healthy controls and 4.52 ± 1.52 in benign nodules and -2.70 ± 1.081 in thyroidectomy (P<0.001).

Serum miR-221 was significantly up regulated in patients with PTC in compared to healthy donors, whereas no significance was observed in thyroidectomy Serum miR-221 expression in compared to healthy controls.

Serum miR-146b in PTC

Alteration of miR-146b expression level relative to the reference GAPDH in healthy controls, PTC patients, patients with benign nodules and patients after thyroidectomy were assessed (Table 3).

Sample GAPDH CT miR-146b CT ΔCT (Avg. GAPDH – Avg. miR-146b) ΔΔCT (Avg. ΔCT
Avg. ΔCT control)
Normalized miR-146b expression
relative to control 2-ΔΔCT
Control 30.8328 28.49 2.3416 - 1.00
PTC 31.7544 12.65 19.0996 -16.7580 110,830.85
Benign nodule 30.6216 26.31 4.3140 -1.9724 3.92
Thyroidectomy 30.7944 28.53 2.2676 0.0740 0.95
  Sum of Squares df Mean Square F Sig.
Between Groups 4942.77 3 1647.592 310.714 0.000
Within Groups 509.05 96 5.303    
Total 5451.827 99      

Table 3: Alteration of miR-146 expression level relative to the GAPDH.

The mean (±SD) ΔCT value was 19.099 ± 3.498 in the 25 samples from patients with PTC and 2.341 ± 1.959 in healthy controls and 4.314 ± 1.684 in benign nodules and -2.267 ± 1.514 in thyroidectomy (P<0.001).

Serum miR-146b was significantly up regulated in patients with PTC in compared to healthy donors, whereas no significance was observed in thyroidectomy Serum miR-146b expression in compared to healthy controls.

After inserting data to the Rest software, the following results reported:

1. MiR-221 is UP-regulated in papillary group [in comparison to control group] by a mean factor of 4.696 [S.E. range is 2.309 - 9.460]. MiR-221 papillary group is different to control group. P [H1] =0.000. MiR-146b is UP-regulated in papillary group [in comparison to control group] by a mean factor of 9.853 [S.E. range is 6.217 - 15.227]. MiR- 146b papillary group is different to control group. P [H1] =0.000 (Figure 1).

molecular-biomarkers-diagnosis-papillary-group

Figure 1: MiR-221 is UP-regulated in papillary group (in comparison to control group) by a mean factor of 4.696 (S.E. range is 2.309 - 9.460), MiR-221 papillary group is different to control group, P (H1)=0.000 MiR-146b is UP-regulated in papillary group (in comparison to control group) by a mean factor of 9.853 (S.E. range is 6.217 - 15.227), MiR-146b papillary group is different to control group, P (H1)=0.000.

2. MiRNA-221 benign group is not different to control group. P [H1] =0.116. MiRNA-146b benign group is not different to control group. P [H1] =0.070 (Figure 2).

molecular-biomarkers-diagnosis-benign-group

Figure 2: MiRNA-221 benign group is not different to control group, P (H1) =0.116, MiRNA-146b benign group is not different to control group, P (H1)=0.070.

3. MiR-221 thyroidectomy group is not different to normal group. P [H1] =0.517. MiRNA-146b thyroidectomy group is not different to control group. P [H1] =0.889 (Figure 3).

molecular-biomarkers-diagnosis-thyroidectomy-group

Figure 3: MiR-221 thyroidectomy group is not different to normal group, P (H1) =0.517, MiRNA-146b thyroidectomy group is not different to control group, P (H1)=0.889.

Dual comparison of Serum miR-221 & miR-146b in PTC

Box plots of miRNA CT value in sera of patients with PTC (n = 25) and benign thyroid nodules (n = 25) and thyroidectomy (n=25) in comparison with healthy controls (n = 25). The levels of serum miR-221 (Blue), miR-146b (Orange) were significantly higher in PTC patients than in patients with benign nodules and thyroidectomy (Figure 4).

molecular-biomarkers-diagnosis-Box-plots

Figure 4: Box plots of miRNA CT value in sera of patients with PTC (n=25) and benign thyroid nodules (n=25) and thyroidectomy (n=25) in comparison with healthy controls (n=25), The levels of serum miR-221 (Blue), miR-146b (Orange) were significantly higher in PTC patients than in patients with benign nodules and thyroidectomy.

Discussion

Several microarray analysis study indicated that 11 miRNAs were deregulated, by at least 2-fold, in PTC compared to benign nodules. Four were down-regulated (miR-122, miR-183, miR-149, and miR- 514a) and seven were up-regulated (miR-146b, miR-222, miR-221, miR-10b, miR-199a/miR-199b, miR-203 and miR-32) [23,24]. MiR- 221, miR-222 and miR-146b were also up-regulated in experimental models of thyroid tumorigenesis [16,25]. Increasing evidence shows that cancer-derived exosomes contain miRNAs, which regulate the proliferation of recipient cells. In indolent PTC, PTC-derived exosomes contain miR-146b and miR-222, which alter proliferation of other cells in a complex manner [26]. He et al. identified a miRNA expression signature consisting of 23 miRNAs, of which 17 showed overexpression between 1.5-fold to 19.3-fold, and six showed less than 2-fold reduction in expression. Five overexpressed miRNAs were sufficient to predict cancer status, and the three most overexpressed miRNAs, miR-146, miR-221, and miR-222, were associated with the down-regulation of KIT gene [27]. The miRNA-chromatin immunoprecipitation microarray assay revealed up-regulation of a set of miRNAs, including miR-221, miR-222, miR-146, miR-21, miR-155, miR-181a, and miR- 181b, in PTCs compared with those in normal thyroid as well as a series of down-regulated miRNAs, such as miR-26a-1,miR-219–5p, and miR-345 [28]. Many publications have reported that PTC samples with different degrees of aggressiveness present different microRNA expression profiles, on the basis of microarrays and qRT-PCR analyses. These studies revealed the common up-regulation of the wellcharacterized miR-146b-5p, miR-221-3p and miR-222-3p in aggressive PTC compared to non-aggressive samples but no commonly down regulated microRNAs [24]. Through to investigations, it was revealed that miRNAs found in the exosomes are associated with a variety of specific diseases such as cancer, for example, research has shown that exosomes in blood circulation are similar to exosomes in the origin of their cancer cells. This suggests that miRNAs in exosomes have the potential to diagnose cancer [29]. In patients with papillary thyroid cancer, over expression of miR-146b in the blood might act as a diagnostic indicator [30]. Several recent studies, including our results, have provided evidence that overexpression of miR-146b plays a critical role in PTC progression and patient prognosis [31]. Furthermore, miRNA signatures have been investigated in thyroid cancer, and researchers have found that miRNA expression profiles were able to differentiate benign from malignant thyroid lesions, suggesting that miRNAs might serve as diagnostic biomarkers for thyroid cancer. However, different accuracies and conflicting results were obtained in different research studies [32-34]. Another study suggested that the results using a panel of 4 miRNAs (miR-328, miR-21, miR-197, and miR-221), which yielded a sensitivity of 86% and a specificity of 85% in discriminating malignant from benign nodules, were higher than those obtained from a panel of 2 miRNAs (miR-21 and miR-328), which yielded a sensitivity of 71% and a specificity of 85%, or than those obtained using the individual miR-21, with a sensitivity of 69% and a specificity of 86%, indicating that panels consisting of multiple miRNAs possessed higher diagnostic accuracy [35]. In addition, Shen et al. found that the diagnostic utility of miR-221, miR-146b, miR- 187, and miR-30d in PTC, follicular variant of PTC (FPTC), follicular thyroid cancer (FTC), and anaplastic thyroid carcinoma [ATC] could differentiate malignant from benign lesions with a sensitivity of 93.2% and a specificity of 93.8%. However, when the 4 miRNAs were used in PTC, FTC and FPTC without ATC, the sensitivity dropped to 88.9% and the specificity dropped to 78.3%, suggesting that the relative frequencies of FTCs might have an influence on the results of diagnostic value estimation, and also that it may be more difficult to distinguish FTCs from benign lesions [36]. Despite years of attempt to identify tumor marker for human cancers, no tumor marker has generated the excitement that has accompanied the fondness in the potential of miRNAs [37]. In recent decade, many researchers have shown that miRNAs expression is deregulated in many types of human carcinomas, including thyroid. Among the differentially expressed miRs, miR-221, miR-222 and miR-146b were the most highly upregulated. Our study indicates that an upregulation of miR-221 and miR-146b expression in blood samples can differentiate PTC from normal, benign thyroid nodules and thyroidectomy patients. The miR-221 and miR-146b are relatively stable in most body fluids and, making these small RNA molecules ideal biomarkers for differential diagnostic applications.

Conclusion

This study shows that miR-221 and miR-146b, which are overexpressed in PTC, could play a significant role in a novel diagnostic approach and suggests a critical role of miR-221 and miR- 146b overexpression in thyroid tumorigenesis.

Collectively, the overexpression of miR-221 and miR-146b could be potentially served as serum indicator biomarkers in the approach for Thyroid Papillary Carcinoma detection from benign nodules.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

  • 2nd World Congress on Molecular Genetics and Gene Therapy
    July 03-05, 2017 Thailand, Bangkok
  • 9th International Conference and Expo on Molecular & Cancer Biomarkers
    August 23-24, 2017 Birmingham, UK
  • 2nd International Conference on Medical Imaging and Diagnosis
    London, UK
  • 22nd International Conference on Cancer Drugs and Therapeutics
    Paris, France
  • International Conference on Oncology Nursing and Cancer Care
    Singapore City, Singapore
  • World Summit on Cell Signalling and Cancer Therapy
    Toronto, Canada
  • International Conference on Radiology and Imaging
    New York, USA

Article Usage

  • Total views: 473
  • [From(publication date):
    specialissue-2017 - Jun 27, 2017]
  • Breakdown by view type
  • HTML page views : 428
  • PDF downloads :45
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

agrifoodaquavet@omicsonline.com

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

clinical_biochem@omicsonline.com

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

business@omicsonline.com

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

chemicaleng_chemistry@omicsonline.com

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

environmentalsci@omicsonline.com

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

engineering@omicsonline.com

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

generalsci_healthcare@omicsonline.com

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

genetics_molbio@omicsonline.com

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

immuno_microbio@omicsonline.com

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

omics@omicsonline.com

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

materialsci@omicsonline.com

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

mathematics_physics@omicsonline.com

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

medical@omicsonline.com

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

neuro_psychology@omicsonline.com

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

pharma@omicsonline.com

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

social_politicalsci@omicsonline.com

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords