alexa The TNFR In Asterias rubens Sea Star: Genomic Studies | OMICS International
ISSN: 2157-7633
Journal of Stem Cell Research & Therapy
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

The TNFR In Asterias rubens Sea Star: Genomic Studies

Michel Leclerc1 and Nicolas Kresdorn2*

1Department of Cell Biology, Developmental Biology, Immunology, University of Orléans, Orléans, France

2GenXPro, Frankfurt, Germany

*Corresponding Author:
Nicolas Kresdorn
GenXpro de. Frankfurt, Germany
E-mail: [email protected]

Received date: June 10, 2016; Accepted date: June 27, 2016; Published date: June 30, 2016

Citation: Leclerc M, Kresdorn N (2016) The TNFR In Asterias rubens Sea Star: Genomic Studies. J Stem Cell Res Ther 6:346. doi:10.4172/2157-7633.1000346

Copyright: © 2016 Leclerc M, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Stem Cell Research & Therapy

Abstract

The sea star Asterias rubens includes TNFR, in its genome, when compared to mouse one: mouse isoform 2 of TNF AIP3-interacting protein 1, mouse TNF receptor-associated factor 2, mouse TNF receptor-associated factor 3, mouse TNF receptor-associated factor 4, mouse TNF receptor-associated factor 6. Many of these factors are bound to NF Kappa -B genes which have recently been isolated in the Asterias rubens genome. They play a rôle in the regulation of the sea star immune system.

Keywords

Asterias rubens; Genome; Sea stars

Introduction

Tumor necrosis factor receptor (TNFR)- associated factors belong to a family of intracellular adaptor proteins that mediate signaling downstream of various cell surface receptors, including members of the TNFR superfamily [1].

TNFR have been described in mammals, Drosophila and Caenorhabditis elegans and are characterized by conserved structural motifs [2].

TNFR are related to detective activation of kinases and/or transcription factors such as NF Kappa-B. NF Kappa-B genes have been discovered recently in Asterias rubens [3].

In the present paper, we research TNFR, in immunized and nonimmunized sea stars to HRP, in their genome, when compared to mouse genome.

Materials and Methods

a) Sea stars were obtained from the Biology Institute (Gothenbugh University). Immunizations to HRP, Genomic studies were already described [4].

b) After ligation of adapters for Illumina 's GSII sequencing system, the cDNA was sequenced on the Illumina GSII sequencing.

c) 100 bp from one side of the approximately 200 bp fragments sequences were assembled using Velvet [5].

Results

First results concern non-immunized sea stars to HRP: (a) Evidence of isoform 2 of TNFAIP3-interacting protein 1 in sea star Asterias rubens:

One contig (Contig2216) could be annotated via BLASTX to Mus musculus "Isoform 2 of TNFAIP3-interacting protein 1" from the Swissprot database (TNIP1_MOUSE), with an e-value of 2.33e-17. On an aligned region of 406 amino acids, 193 positive and 101 identical amino acids were found.

5'ACGTCCTTAGCAACACCCTTGACAACAGCCGTAGCCGT

AGCCGGCAATTCCAACACGGCTTGGCTTGAGTCTGCAAC

AATGCGTTGTACTTCTCTTTGCAAGTTTCTACATTTGTCT

AGACAGCTGCAATTAGTTGACGCAAAGATAACCTTTATA

AAACAATTTCGTAACTAATCAACATATTTGCTAGACTTG

ATTTCAAGTCTGAGACTGCGGTTATTTCTCTGCATCAGCC

ATGAAGAATTCC 3'

b) Evidence of TNF receptor-associated factor 2 in sea star Asterias rubens:

One contig (Contig15544) could be annotated via BLASTX to Mus musculus "TNF receptor-associated factor 2" from the Swissprot database (TRAF2_MOUSE), with an e-value of 5.52e-49. On an aligned region of 137 amino acids, 112 positive and 86 identical amino acids were found.

5'ATTGATCTTCCAGAGCAGCACCCCGTCGTAGGATGACG

CCAAGAGGGAGTATCGGGTAAAACCACTTCATTCTACTC

GCCTGTTTTCTACACCAGCCGACATGGCTATAAGCTCTC

TGCAAGGATCTACTTGAATGGAGATGGGTTAGGGAAAC

ACACGCACATGTCGCTTTTCTTTGTGGTCATGCGAGGGC

GCCATGACGCTCTCCTTCCGTGGCCTTTCCACCAGAAGG

TGACCTTCATGCTGATGAATCAGAACAACCGGGAGCACG

TCATTGACGCCTTCAGACCAGACCCTGCAAGCTCCTCGT

TCAAACGGCCCAACAGTGACATGAATGTTGCTTCCGGAT

GTCCGCTCTTCATTGCGCAGGAAGTCCTGGATTCAACTG

ACAGTTTCATCAAAGACGACACAATGTTTGTCAAAGTCG

TTGTCGATAATGTTGGATTGGACAACATTTGAACAATGA

CAGTGACAAAGCCGTGTCCAAATTGGTAATCACAGCTGT

GGCTACGACAGGATTTCTGCGTCATCATGTAATATAGCA

TCCTGTATAGCAACAGTTGTAGCAATAGCTGTAGCCAGC

AGTTCGAATATGACCCGACTTTGCTGGATACAAGTGGTG

CTTATTTTAAATAGTGGCAAGTTGCCCCCAAATGTCTTCG

TATGCATAATTGATGCGATGTGAAGATTTAACACAAGCT

GTGAGTTCGCACCAAATGTGTGACGCTCGGCTGAAGTTA

AACATTTTTTTCTGTAGTCCACGGGAAAAAAATTTATAAC

AGGTGACTCT 3'

c) Evidence of TNF receptor-associated factor 4 in immunized sea star Asterias rubens to HRP :

One contig (Contig12096|m.10269) could be annotated via BLASTX to Mus musculus "TNF receptor-associated factor 4" from the Swissprot database (TRAF4_MOUSE), with an e-value of 5.38e-14. On an aligned region of 132 amino acids, 67 positive and 41 identical amino acids were found.

5'CGAATGCAGTGGACTTGCATGCAGTCTTGCTCGTTTTT

CATGACATGGCCCTAGCCCCGGTGGTCTTACACTTTCGT

ACTGTATCTGTGTACAGAGGAATAGTCGTATAGGGCTAG

ACATGGCCCTAACATTCAATCGTGATCGCTGACCAGACA

TCAGACTTGACTTTATACACAGCGTGCATGACTTTGGAA

GAATACTGACCATTTTATGAAAACATCTTTCTTCTTCTTT

CTTCTTGCAGGTCAAAGATCACGTAGAGAACGACTGCCC

CAAGGCGAAGATACCCTGCCCATTTCAAACTATGGGTTG

TGACTTTAAGGGTGAACGTCAAAAGATGCAGAAACACGT

GCAAGACGAGCCAGTGGAGCATCTGACCTACGTAGGGG

ATTCGATGCTGAAGCACGCTACACTACTGGAGAAACACA

AGGAGATGCTTGTTGACCATAAGGAGTCTTTGGGCACGT

GCGTGCAGAAGGTCCGCGATCTTGAGATGCTGTACGGCT

CACAGCTCGTCTGGAAAATCGACCGCTACGCCGAGAGGA

TGCAGGAGGCAAAGACCAACAAGAAAGTGACCATCTTC

AGCCCGCCATTTCTAACCAGTCGACATGGTTACAAGATG

ACGGTATCGGCTTGTCTGAACGGCGAC 3'

Discussion and Conclusion

It is apparent that, with the exception of Asterias rubens and, to a lesser degree, Drosophila, our understanding of invertebrate TNFR system, is still lacking in detail.

It is true that Liu [2] has identified a Drosophila TNF receptorassociated factor:DTRAF1, but not really the mouse TNF receptorassociated factor 2 which is found in Asterias rubens: we may speak of homologies between these factors.

In the same manner a homolog of mouse isoform 2 of TNFAIP3- interacting protein 1, discovered in A.rubens, exists in Drosophila. This factor inhibits NF Kappa-B activation and TNF-induced NF Kappa-B dependent gene in vertebrates. We recall that NF Kappa-B genes have been discovered recently in Asterias rubens [3].

At last, an enigmatic TNF receptor-associated factor 4 appears in immunized sea stars to HRP and not in non-immunized sea stars. We have already observed such phenomenon due to the immunization : it remains unanswered.

In conclusion, such a sophisticated defense system( Invertebrate primitive antibody, TNFR system) has all saved the sea star to survive for more than 200 million years on the earth.

Reference

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

  • 20th Global Congress on Biotechnology March 5-7, 2018 London, UK
    March 5-7, 2018 London, UK
  • 7th International Conference and Exhibition on Cell and Gene Therapy March 15-16, 2018 London,UK
    March 15-16, 2018 London, UK
  • 10th World Congress and Expo on Cell & Stem Cell Research March 19-21, 2018 New York, USA
    March 19-21, 2018 New York, USA
  • 4th World Congress on Human Genetics and Genetic Diseases April 19-20, 2018 Dubai, UAE
    April 19-20, 2018 Dubai, UAE
  • 3rd International Conference on Molecular Medicine and Diagnostics April 19-20, 2018 Dubai,UAE
    April 19-20, 2018 Dubai, UAE
  • 11th World Congress on Cell & Tissue Science May 09-10, 2018 Tokyo, Japan
    July 19-20, 2018 Dubai, UAE
  • 11th World Congress on Cell & Tissue Science May 09-10, 2018 Tokyo, Japan
    May 09-10, 2018 Tokyo, Japan
  • 6th International Conference on Integrative Biology May 21-23, 2018 Barcelona, Spain
    May 21-23, 2018 Barcelona, Spain
  • 10th International Conference on Genomics and Molecular Biology May 21-23, 2018 Barcelona, Spain
    May 21-23, 2018 Barcelona, Spain
  • 12th Annual Conference on Stem Cell and Regenerative Medicine June 04-06, 2018 Prague, Czech Republic
    June 04-06, 2018 Prague, Czech Republic
  • 4th International Conference on Bioscience July 2-3, 2018 Vienna, Austria
    July 2-3, 2018 Vienna, Austria
  • 22nd World Congress on Biotechnology July 10-11, 2018 Bangkok, Thailand
    April 16-18, 2018 Amsterdam, Netherlands
  • 9th International Conference on Tissue Science and Regenerative Medicine July 13-14, 2018 Sydney, Australia
    April 23-24, 2018 Las Vegas, USA
  • 10th Annual Conference on Stem Cell and Regenerative Medicine August 13-14, 2018 London, UK
    August 13-14, 2018 London, UK
  • World Congress on Stem Cell Biology and Biobanking September 3-4, 2018 Tokyo, Japan
    September 3-4, 2018 Tokyo, Japan
  • 2nd Annual summit on Cell Metabolism and Cytopathology September 19 - 20, 2018 Philadelphia, Pennsylvania, USA
    September 19 - 20, 2018 Philadelphia, USA
  • 2nd Annual summit on Cell Signaling and Cancer Therapy September 19 - 20, 2018 Philadelphia, Pennsylvania, USA
    September 19 - 20, 2018 Philadelphia, USA
  • 6th Annual Congress on Biology and Medicine of Molecules September 20-21,2018 Kuala Lumpur, Malaysia
    September 20-21,2018 Kualalumpur, Malaysia
  • 5th International Conference on Human Genetics and Genetic Disorders September 21-22,2018 Philadelphia, Pennsylvania, USA
    September 21-22,2018 Philadelphia, USA
  • 11th International Conference on Genomics and Pharmacogenomics September 21-22, 2018 Philadelphia, Pennsylvania, USA
    September 21-22, 2018 Philadelphia, USA
  • 5th World Congress on HUMAN GENETICS SEPTEMBER 24-25, 2018 BERLIN, GERMANY
    SEPTEMBER 24-25, 2018 Berlin, Germany
  • 21st Euro Biotechnology Congress October 11-12, 2018 Moscow, Russia
    October 11-12, 2018 Moscow, Russia
  • 11th International Conference on Tissue Engineering & Regenerative Medicine October 18-20, 2018 Rome, Italy
    October 18-20, 2018 Rome, Italy
  • 24th Biotechnology Congress: Research & Innovations October 24-25, 2018 Boston, USA
    October 24-25, 2018 Boston, USA
  • International Conference on Human Genome Meeting October 25-26, 2018 Istanbul, Turkey
    October 25-26, 2018 Istanbul, Turkey
  • International Congress & Expo on Genomics and Bioinformatics November 2-3, 2018 Columbus, Ohio, USA
    November 2-3, 2018 Columbus, USA
  • 12th International Conference & Exhibition on Tissue Preservation and Biobanking November 9-10, 2018 Atlanta, Georgia, USA
    November 9-10, 2018 Atlanta, USA
  • 2nd Annual Summit on Cell Therapy and Stem Cell Research November 9-10, 2018 Atlanta, Georgia, USA
    November 9-10, 2018 Atlanta, USA

Article Usage

  • Total views: 8072
  • [From(publication date):
    July-2016 - Dec 13, 2017]
  • Breakdown by view type
  • HTML page views : 8001
  • PDF downloads : 71
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version