alexa TNFRSF13B Variants in SLE and Immunodeficiency | Open Access Journals
ISSN: 2155-9899
Journal of Clinical & Cellular Immunology
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

TNFRSF13B Variants in SLE and Immunodeficiency

Chew GYJ1-3, Gatenby PA1*, Mercan S4, De Malmanche T5, Adelstein S6, Garsia R6, Hissaria P7, French MA8, Riminton DS9, Fulcher DA10, Scorza R11, D'Alfonso S12, Doria A13, Rúa Figueroa I14, Cervera R15, Vasconcelos C16, Martins B16, Alarcón Riquelme M17,18, Vinuesa CG2 and Cook MC1,2
1Department of Immunology, Canberra Hospital, Australia
2John Curtin School of Medical Research, Australian National University, Australia
3Graduate School of Medicine, University of Wollongong, Australia
4Department of Genetics, Research Institute of Medical Experiment, Istanbul University, Turkey & Department of Bioengineering, Faculty of Engineering and Architecture, Kafkas University, Turkey
5HAPS Immunology, Newcastle, Australia
6Department of Immunology, Royal Prince Alfred Hospital, Sydney, Australia
7Department of Human Immunology, SA Pathology & Clinical Immunology and Allergy, Royal Adelaide Hospital, Australia
8Department of Clinical Immunology and Path West Laboratory Medicine, Royal Perth Hospital, Perth, Australia & School of Pathology and Laboratory Medicine, University of Western Australia, Australia
9Department of Immunology, Concord Hospital, Concord, Australia
10Department of Immunopathology, Westmead Hospital, Westmead, Australia
11University of Milan, Milan, Italy
12Department of Health Sciences and IRCAD, University of Eastern Piedmont, Novara, Italy
13Division of Rheumatology, University of Padova, Padova, Italy
14Servicio de Reumatología, Hospital Universitario Doctor Negrín, Las Palmas de Gran Canaria, Spain
15Department of Autoimmune Diseases, Hospital Clínic, Barcelona, Catalonia, Spain
16Centro Hospitalar do Porto/Hospital Santo Antonio and UMIB/ICBAS, Porto, Portugal
17Department of Human DNA Variability, GENYO, Centro de Genómica e Investigación Oncológica Pfizer-Universidad de Granada—Junta de Andalucía, Granada, Spain
18Arthritis and Clinical Immunology Program, Oklahoma Medical Research Foundation, Oklahoma, OK, USA
Corresponding Author : Professor Paul A Gatenby
Department of Immunology
Canberra Hospital, Australia
Tel: 61 2 6244 3955
E-mail: [email protected]
Received March 10, 2014; Accepted July 09, 2014; Published July 16, 2014
Citation: Chew GYJ, Gatenby PA, Mercan S, De Malmanche T, Adelstein S, et al. (2014) TNFRSF13B Variants in SLE and Immunodeficiency. J Clin Cell Immunol 5:233. doi:10.4172/2155-9899.1000233
Copyright: © 2014 Chew GYJ, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Related article at
DownloadPubmed DownloadScholar Google

Visit for more related articles at Journal of Clinical & Cellular Immunology

Abstract

Background: The co-existence of autoimmunity and primary antibody deficiency in some individiuals is intriguing. The transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI) gene (TNFRSF13B) has been implicated in both autoimmunity and primary antibody deficiency to varying extents in mice and humans. However, the phenotype described in mice with TNFRSF13B polymorphisms has not been entirely consistent with patients with similar orthologous polymorphisms.

Objective: To further understand the relationship between TNFRSF13B variants and PAD and autoimmunity, we set out to determine the association of the two most common TNFRSF13B polymorphisms with autoimmunity and immunodeficiency, in patients with primary antibody deficiency and SLE.

Method: We genotyped the C104R and A181E polymorphisms of TNFRSF13B in193 individuals and 144 controls from the Australian and New Zealand Antibody Deficiency Allele (ANZADA) Study, 107 patients from the Australian Point Mutation in Systemic Lupus Erythematosus (APOSLE) study, 169 patients with SLE from a European population, and 263 European controls. We were also able to determine TNFRSF13B genotypes for family members for nine of twelve pedigrees with primary antibody deficiency identified with TNFRSF13B variants.

Results: The total number of TNFRSF13B variants in the primary antibody deficiency cohort was significantly higher than in the control group (p=0.0089; OR 9.481 [95% CI 1.218−73.81]). Similar results were obtained when patients with systemic lupus erythematosus were analysed. TNFRSF13B variants were strongly associated with SLE (p=0.0161, OR 3.316 [95% CI 1.245-8.836]). Familial analysis revealed incomplete penetrance of the TNFRSF13B variants.

Conclusion: Taken together, the two most common TNFRSF13B variants are associated with primary antibody deficiency and systemic lupus erythematosus.

Abstract

Background: The co-existence of autoimmunity and primary antibody deficiency in some individiuals is intriguing. The transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI) gene (TNFRSF13B) has been implicated in both autoimmunity and primary antibody deficiency to varying extents in mice and humans. However, the phenotype described in mice with TNFRSF13B polymorphisms has not been entirely consistent with patients with similar orthologous polymorphisms.

Objective: To further understand the relationship between TNFRSF13B variants and PAD and autoimmunity, we set out to determine the association of the two most common TNFRSF13B polymorphisms with autoimmunity and immunodeficiency, in patients with primary antibody deficiency and SLE.

Method: We genotyped the C104R and A181E polymorphisms of TNFRSF13B in193 individuals and 144 controls from the Australian and New Zealand Antibody Deficiency Allele (ANZADA) Study, 107 patients from the Australian Point Mutation in Systemic Lupus Erythematosus (APOSLE) study, 169 patients with SLE from a European population, and 263 European controls. We were also able to determine TNFRSF13B genotypes for family members for nine of twelve pedigrees with primary antibody deficiency identified with TNFRSF13B variants.

Results: The total number of TNFRSF13B variants in the primary antibody deficiency cohort was significantly higher than in the control group (p=0.0089; OR 9.481 [95% CI 1.218−73.81]). Similar results were obtained when patients with systemic lupus erythematosus were analysed. TNFRSF13B variants were strongly associated with SLE (p=0.0161, OR 3.316 [95% CI 1.245-8.836]). Familial analysis revealed incomplete penetrance of the TNFRSF13B variants.

Conclusion: Taken together, the two most common TNFRSF13B variants are associated with primary antibody deficiency and systemic lupus erythematosus.
Keywords

Primary antibody deficiency; Common variable immunodeficiency; Selective IgA deficiency; Immunoglobulin G subclass deficiency; Specific antibody deficiency; Autoimmunity; Transmembrane activator and calcium modulator and cyclophilin ligand interactor
Introduction

Non-congenital primary antibody deficiency (NCPAD) includes common variable immunodeficiency (CVID), selective IgA deficiency (sIgAD), immunoglobulin G subclass deficiency (IgGSD) and specific antibody deficiency (SAD). Shared genetic aetiology amongst these conditions is suggested by observations that different forms of NCPAD cluster within the same kindred, and that in some individuals, less severe forms of immunoglobulin deficiency can progress to complete antibody deficiency [1-3]. In many patients, there is evidence of additional immunological defects in the form of autoimmune disease ranging from autoimmune haematological disease, which is the most common, occurring in approximately 11% of patients, to solid organ-specific autoimmunity and systemic conditions, which also occur in up to 11% of patients [4-7]. These systemic autoimmune diseases include rheumatoid arthritis, sicca syndrome, vasculitis and in particular for this paper, systemic lupus erythematosus (SLE).

A number of studies have identified an increased incidence of antibody defects among patients with autoimmune disease. In a retrospective study of 33 children with an array of autoimmune diseases including systemic diseases such as systemic lupus erythematosus, autoimmune cytopenias and organ specific autoimmune conditions such as Hashimoto’s thyroiditis, autoimmune hepatitis and alopecia areata, 12% of children with autoimmune diseases have some form of NCPAD [8]. Another study established that 4.6% of SLE cases and 4.3% of juvenile idiopathic arthritis cases have sIgAD, which is 10-20 times greater than the prevalence in the general population [9]. There have also been reports of SLE preceeding the onset of hypogammaglobulinemia [10,11]. Furthermore, in a series of 326 patients with CVID, clinical evidence of autoimmunity appeared prior to the onset of immunodeficiency in 54% of patients with autoimmune haematological manifestations [7]. Similarly, Michel and co-workers described a cohort where the initial manifestation in 62% of the 21 patients with CVID and ITP was thrombocytopenia [12].

One explanation for this intriguing association is that immune dysregulation contributes to both immunodeficiency and autoimmunity. We will consider the underlying mechanisms including some of own data and a review of published literature to set these findings in context. In particular, we describe genetic variants that appear to be shared between SLE and CVID.

Polymorphisms in the transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI) gene (TNFRSF13B) have been identified in patients with primary antibody deficiencies [13,14]. Disease associated variants include C104R, A181E, R202H, S114X and S194X [13,14]. Polymorphisms of TNFRSF13B also occur in people with no evidence of immune deficiency, including healthy relatives of CVID patients [13,15,16].

The most robust associations appear to be between polymorphisms encoding C104R and A181E and CVID [17]. Together, these variants have been identified in up to 10% of individuals with CVID, compared with up to 2% of immune competent controls [13,14,18,19]. While one study found an increased prevalence of TNFRSF13B variant in patients with sIgAD [14], this has not been replicated in other studies [15,20]. In summary, C104R and A181E polymorphisms appear to act dominantly to increase the risk of antibody deficiency.

The mechanism that accounts for this association remains unclear. Total serum immunoglobulin levels were not impaired in TACI-/- mice [21,22]. Indeed, these mice developed features of autoimmunity (diffuse membranoproliferative glomerulonephritis, positive antinuclear antibodies and double stranded DNA antibodies consistent with systemic lupus erythematosus (SLE)), lymphoproliferation and splenomegaly, and 15% went on to develop lymphoma [22,23]. Autoimmunity, lymphoproliferation and splenomegaly were not seen in all individual mice with TNFRSF13B polymorphisms.

The amino acid sequences surrounding both the C104R and A181E variants are highly conserved between humans and mice. The C104R variant in the extracellular domain disrupts the cysteine-rich region that is vital for ligand binding [24,25]. More recently, Lee and colleagues produced evidence of TACI haploinsufficiency in mice heterozygous for the orthologous variant to human C104R (C76R) [26]. Although the mice had evidence of defective T cell-independent responses to polysaccharides and decreased serum IgM, serum IgG and IgA levels were normal [26]. There was no evidence of B cell lymphoproliferation or splenomegaly. Mice with the A144E variant, the murine ortholog of human A181E variant, exhibited reduced serum IgA and IgM as well as impaired responses to T cell-independent antigens [27], but did not develop B cell lymphoproliferation or anti-DNA antibodies.

Here, we report the association between between the A181E and C104R polymorphisms of TNFRSF13B in patients with primary antibody deficiency and SLE.
Method

Subjects

We genotyped 193 individuals and 144 controls from the Australian and New Zealand Antibody Deficiency Allele (ANZADA) Study, 107 patients from the Australian Point Mutation in Systemic Lupus Erythematosus (APOSLE) study, 169 patients with SLE from a European population, and 263 European controls. The controls consisted of individuals without a personal or family history of immunodeficiency or autoimmunity, drawn from the same population. Ethics approval was obtained from each participating institution.
Genotyping

Genomic DNA was extracted from saliva collected from subjects using the Oragene DNA collection kit (DNA Genotek, Ontario, Canada), based on the protocol provided by the manufacturer. Allele-specific forward primers and the common reverse primer for both C104R (GAAGGTCGGAGTCAACGGATTCCCTAAGCAATGTGCATACTTCC,GAAGGTGACCAAGTTCATGCTACCCTAAGCAATGTGCATACTTCTandTGGGCTCCTGAGCTTGTT)andA181E (GAAGGTGACCAAGTTCATGCTTCTGCTGCTTCCTGGTGGA,AAGGTCGGAGTCAACGGATTTGCTGCTTCCTGGTGGCandGACTTTGACGGGGCCTT) single nucleotide polymorphisms (SNP) were designed using Amplifluor® Assay Architect Software (www.apps.serologicals.com/AAA, Millipore, MA, USA).

A cocktail consisting of water, deoxynucleotide triphosphates, platinum TAQ polymerase (Invitrogen, Carlsbad, Calif), 20Amplifluor SNP FAM primer, 20Amplifluor SNP JOE primer, SNP-specific primers, and 10reaction mix S plus is added to individual DNA samples and a PCR program was run on a thermocycler. Subsequent to the completion of the PCR procedure, samples were cooled to room temperature and analyzed on the FLUOstar OPTIMA microplate reader (BMG Labtech, Offenburg, Germany). Results obtained from the microplate reader were transferred to a Microsoft Excel macro provided by Millipore and analysed.

Sequencing was also used to confirm subsets from each Amplifluor genotype. Thus, DNA from representative samples from each Amplifluor® run, encoding the wild-type and heterozygous and homozygous variants, was sequenced after the region was amplified by PCR using the conventionally designed primers (C104R-5'-CTTTGTGGTCAAACCCAGAG-3'and5'-CTGGGCTTC ATGCATTGTGG-3’;A181E-5'-TTGAGCCTAATGACGGGAAG-3'and5'-TGCCAGGATGTCTTAACCTG-3') to confirm the validity of the Amplifluor® results.

DNA from patients with NCPAD that were found to have either the C104R or A181E variant was amplified by PCR and sequenced by conventional sequencing to exclude the possibility of biallelic TNFRSF13B variants, using the following primers (Exon 1-5’-GGGTGTGGCTGATTTACAT-3’and5’-CTTTGCACCT GCTGGAC-3’;Exon2-5’-GCCCCAGGCCCCTAGCAAGTG-3’ and5’TCTCCTCCTGCCACCCTTTCCTCA-3’;Exon3- 5'-CTTTGTGGTCAAACCCAGAG-3'and5'-CTGGGCTTCATGCATTGTGG-3’; Exon4-5'-TTGAGCCTAATGACGGGAAG-3'and5'-CTGCCAGGATGTCTTAACCTG-3';Exon5-5’-GTGATTGCCCTTAGCTCCTG-3’and5’TCTCCATCTCTCTCCCTCCTC-3’).
Statistics

Genotypic and allelic frequencies were compared using the Fisher exact test. These tests, together with the OR, relative risk and 95% CI were performed with GraphPad Prism 5.0 software (Graph-Pad Software, La Jolla, Calif). Comparisons were considered significant at p< 0.05.
Results

Frequency of C104R and A181E in NCPAD

We assessed the prevalence of the TNFRSF13B C104R and A181E encoding polymorphisms in 193 patients with NCPAD from the ANZADA cohort, including 171 with a diagnosis of CVID. The remainder had a diagnosis of IgG subclass deficiency (IgGSD, n=11), specific antibody deficiency (SAD, n=6) or immunoglobulin A deficiency (IgAD, n=5).

In the NCPAD cohort, 12 individuals (6.22%) possessed either A181E (n=6) or C104R (n=6) TNFRSF13B polymorphisms. No homozygous variants were detected in the cohort. The prevalence of C104R in the NCPAD cohort was not significantly different to the controls, p=0.2458, but the prevalence of A181E was significantly higher, p=0.0389 (Table 1). The total number of TNFRSF13B variants in the NCPAD cohort was also significantly higher than in the control group (p=0.0089; OR 9.481 [95% CI 1.218−73.81]) (Table 2).

Similar results were obtained when we analysed according to CVID rather than all NCPAD. Here, C104R was not significantly more common in the patient group (4/171 [2.33%]) than the controls (1/144 [0.69%]), p=0.3803 (Table 1). The result was similar for A181E (p=0.0651), with five CVID patients (2.92%) possessing the variant compared to none of the controls (Table 1). However, the association between CVID and the two TNFRSF13B polymorphisms combined was significant (p=0.0240; OR 7.944 [95% CI 0.9938−63.51]) (Table 2). The other two subjects with C104R variants in this cohort had a diagnosis of IgGSD while the other patient with A181E had a diagnosis of SAD. None of the patients had biallelic variants in TNFRSF13B.
Frequency of C104R and A181E in autoimmunity

We next tested the association between C104R and A181E polymorphisms and autoimmunity in the NCPAD cohort. In the Australian NCPAD cohort, 43/193 (22%) individuals had one or more manifestations of autoimmunity, including autoimmune haematological cytopenia, arthritis, autoimmune thyroid disease, Sjogren’s syndrome, vitiligo, psoriasis, autoimmune Addison’s disease and alopecia areata [5]. Of the six individuals with the C104R variant, only one patient (with a diagnosis of CVID) had features of autoimmunity (pernicious anaemia and Sjogren’s syndrome) while three out of six individuals who were heterozygous for A181E had features of autoimmunity. These three individuals with CVID had histories of autoimmune thyroiditis (one individual) and autoimmune cytopenias (two individuals). No association was found between C104R or A181E in NCPAD patients with autoimmunity (p=0.871 and p=0.246 respectively). There was also no association when both variants were combined (p=0.5538).

The frequencies of C104R and A181E were next determined in patients with SLE (Australian Point Mutation in SLE, APOSLE cohort). The C104R variant was more prevalent than the A181E variant in the Australian SLE cohort. 4/107 (3.74%) SLE patients possessed the C104R polymorphism while none had the A181E polymorphism. Although the C104R polymorphism was more prevalent than in the Australian control cohort (3.74% vs 0.69%), this difference did not reach statistical significance (p=0.1668).

These analyses were repeated in a second SLE cohort. In the European SLE cohort, 6/169 (3.55%) individuals possessed a C104R polymorphism while only 3/167 (1.80%) individuals possessed the A181E variant. Two samples from the European cohort and one control from the European control cohort did not amplify with the A181E Amplifluor® assay or by direct PCR and these samples were excluded from our analysis. The C104R polymorphism was 3.12 times more common in the European SLE cohort than the European control cohort (3.55% vs. 1.14%) while A181E was 2.36 times more common (1.80% vs. 0.76%) in the European SLE cohort compared to the European control cohort. In this European SLE cohort, the C104R mutation was 1.98 times more common than the A181E polymorphism (Table 3).

When the results from Australian and European SLE cohorts were combined, C104R was significantly associated with SLE (p=0.0249, OR 3.797, [95% CI 1.178-12.24]) compared to combined Australian and European control cohorts (Table 4), while A181E was not (p=0.3965) (Table 5). Similarly the C allele in C104R was strongly associated with SLE (p=0.0256, OR 3.745 [95% CI 1.168-12.01]). Furthermore, when both heterozygous variants were combined in the analysis, they were associated with SLE (p=0.0161, OR 3.316 [95% CI 1.245-8.836]) (Table 6).
Familial segregation

We were able to determine TNFRSF13B genotypes for family members for nine of twelve pedigrees identified with TNFRSF13B variants. These are shown together with nine other pedigrees within the cohort (Figure 1). While 12/18 pedigrees contain at least one family member with autoimmunity, overall the prevalence in those with TNFRSF13B single nucleotide variants is too low to assess for evidence of transmission disequilibrium. In 8/18 pedigrees, at least one relative had clinical evidence of autoimmunity. In some pedigrees, multiple relatives of probands with antibody deficiency had evidence of autoimmunity alone.
Discussion

With regard to antibody deficiency, our results are similar to those reported for other cohorts. In a large cohort of 564 patients with hypogammaglobulinemia (predominantly CVID, 94.5%) and 675 controls, Salzer and colleagues [16] found the two most common variants to be C104R (4.6%) and A181E (2.3%). Only one patient from each group had homozygous variants. In the control cohort, 1% had the A181E polymorphism while 0.9% possessed the C104R polymorphism. We report a similar prevalence of these genotypes in the Australian (ANZADA) cohort, in both patients and controls, yielding a similar association with disease (A181E, p=0.0398, OR, 10.02; 95% CI, 0.56-179.4; C104R, p=0.2458, OR, 4.59; 95% CI, 0.55-38.56). When both polymorphisms were analysed together, the association between NCPAD and TNFRSF13B variants became significant (p=0.0089; OR, 9.481; 95% CI, 1.22-73.81). In isolation, the results from this study would not achieve a high level of statistical certainty but the association and magnitude of effect is similar to that reported elsewhere [16]. Taken together, we conclude that our NCPAD population is similar with regard to these TNFRSF13B single nucleotide variants.

Salzer and colleagues also found evidence to suggest that autoimmune manifestations in NCPAD were more common in cases with TACI deficiency, particularly with the heterozygous C104R variant [16]. This is in contrast to the findings in the Australian cohort, where there was no association between C104R or A181E alone or in combination in individuals with both antibody deficiency and autoimmunity.

By contrast, we found an association between TNFRSF13B and autoimmunity in the absence of antibody deficiency. The C104R polymorphism was more common in SLE (p=0.0249; OR, 3.797, 95% CI 1.18- 12.24), but A181E was not (p=0.3965). When both these variants were combined, the association of TACI with SLE reached statistical significance (p=0.0161; OR, 3.316, 95% CI 1.17 - 12.01]). This is at odds with another study in which 190 SLE subjects were analysed and no association was found between C104R or A181E and SLE [28].

A review of the literature regarding murine models of TNFRSF13B did not clarify these conflicting findings seen in human studies. Features of SLE are present in TACI knockout mice [21] but not mice with the C76R or A144R polymorphisms (murine equivalents of C104R and A181E respectively) [26,27]. Both TACI knockout mice [21] and mice with the C76R polymorphism [26] demonstrated impaired T cell-independent responses, but total serum IgG was not reduced in either model. Mice with the A144E variant did not have evidence of autoimmunity but had evidence of impaired antibody responses, with reduced total serum IgA and IgM levels, and defective responses to T cell-independent antigens [27].

The high prevalence of autoimmunity in the relatives of patients with NCPAD irrespective of whether they are immunodeficient or whether they possess TNFRSF13B variants, suggest that the risk of autoimmunity exists in families with NCPAD (Figure 1). These preliminary findings suggest that independent genetic modifiers might act to promote either autoimmunity or immune deficiency.

Other PAD have been described with SLE. A number of series report the association between selective IgA deficiency (IgAD) and SLE [29-33]. There is a shared association between the HLA-B8, DR3, DQ2 haplotype of IgAD and autoimmunity. Polymorphisms in non-MHC regions, interferon induced helicase 1 (IFH-1) and the C-type lectin family domain have been detected in recent genome wide association study [34]. A small number of case reports associating SLE and NCPAD with a toll-like receptor signalling defect [35], mannose binding lectin gene polymorphisms [36] and thymoma [37] have been reported. The mechanism underpinning these associations is unclear but has led to the suggestion that IgAD may itself be an autoimmune disease [33].

In summary, the incomplete penetrance revealed by familial analysis and the modest effect of TNFRSF13B polymorphisms on the risk of antibody deficiency and autoimmunity suggest that other interacting factors may play a role in determining whether an individual with a TNFRSF13B variant develop antibody deficiency or autoimmunity. The association between autoimmunity and immunodeficiency reminds us to not disregard the possibility of immunodeficiency in the setting of SLE.
Source of Funding

Supported by the Australian National Health & Medical Research Council project grant 585464 (MCC, DAF); Swedish Research Council and the European Science Foundation BIOLUPUS RNP and the Instituto de Salud Carlos III partially with FEDER funds of the EU (02558). G.Y.J.C is a recipient of an Australian National Health & Medical Research Council Medical Postgraduate Scholarship.
References

  1. Español T, Catala M, Hernandez M, Caragol I, Bertran JM (1996) Development of a common variable immunodeficiency in IgA-deficient patients. Clin Immunol Immunopathol 80: 333-335.

  2. Goldacker S, Warnatz K (2005) Tackling the heterogeneity of CVID. Curr Opin Allergy Clin Immunol 5: 504-509.

  3. Hammarström L, Vorechovsky I, Webster D (2000) Selective IgA deficiency (SIgAD) and common variable immunodeficiency (CVID). Clin Exp Immunol 120: 225-231.

  4. Chapel H, Lucas M, Lee M, Bjorkander J, Webster D, et al. (2008) Common variable immunodeficiency disorders: division into distinct clinical phenotypes. Blood 112: 277-286.

  5. Chew GY, Sinha U, Gatenby PA, DeMalmanche T, Adelstein S, et al. (2013) Autoimmunity in primary antibody deficiency is associated with protein tyrosine phosphatase nonreceptor type 22 (PTPN22). J Allergy Clin Immunol 131: 1130-1135.e1131.

  6. Quinti I, Soresina A, Spadaro G, Martino S, Donnanno S, et al. (2007) Long-term follow-up and outcome of a large cohort of patients with common variable immunodeficiency. J Clin Immunol 27: 308-316.

  7. Wang J, Cunningham-Rundles C (2005) Treatment and outcome of autoimmune hematologic disease in common variable immunodeficiency (CVID). J Autoimmun 25: 57-62.

  8. Barsalou J, Saint-Cyr C, Drouin E, Le Deist F, Haddad E (2011) High prevalence of primary immune deficiencies in children with autoimmune disorders. Clin Exp Rheumatol 29: 125-130.

  9. Liblau RS, Bach JF (1992) Selective IgA deficiency and autoimmunity. Int Arch Allergy Immunol 99: 16-27.

  10. Cronin ME, Balow JE, Tsokos GC (1989) Immunoglobulin deficiency in patients with systemic lupus erythematosus. Clin Exp Rheumatol 7: 359-364.

  11. Swaak AJ, van den Brink HG (1996) Common variable immunodeficiency in a patient with systemic lupus erythematosus. Lupus 5: 242-246.

  12. Michel M, Chanet V, Galicier L, Ruivard M, Levy Y, et al. (2004) Autoimmune thrombocytopenic purpura and common variable immunodeficiency: analysis of 21 cases and review of the literature. Medicine 83: 254-263.

  13. Salzer U, Chapel HM, Webster AD, Pan-Hammarström Q, Schmitt-Graeff A, et al. (2005) Mutations in TNFRSF13B encoding TACI are associated with common variable immunodeficiency in humans. Nat Genet 37: 820-828.

  14. Castigli E, Wilson SA, Garibyan L, Rachid R, Bonilla F, et al. (2005) TACI is mutant in common variable immunodeficiency and IgA deficiency. Nat Genet 37: 829-834.

  15. Pan-Hammarstrom Q, Salzer U, Du L, Björkander J, Cunningham-Rundles C, et al. (2007) Reexamining the role of TACI coding variants in common variable immunodeficiency and selective IgA deficiency. Nat Genet 39: 429-430.

  16. Salzer U, Bacchelli C, Buckridge S, Pan-Hammarstrom Q, Jennings S, et al. (2009) Relevance of biallelic versus monoallelic TNFRSF13B mutations in distinguishing disease-causing from risk-increasing TNFRSF13B variants in antibody deficiency syndromes. Blood 113: 1967-1976.

  17. Castigli E, Wilson S, Garibyan L, Rachid R, Bonilla F, et al. (2007) Reexamining the role of TACI coding variants in common variable immunodeficiency and selective IgA deficiency. Nat Genet 39: 430-431.

  18. Park SR, Zan H, Pal Z, Zhang J, Al-Qahtani A, et al. (2009) HoxC4 binds to the promoter of the cytidine deaminase AID gene to induce AID expression, class-switch DNA recombination and somatic hypermutation. Nat Immunol 10: 540-550.

  19. Zhang L, Radigan L, Salzer U, Behrens TW, Grimbacher B, et al. (2007) Transmembrane activator and calcium-modulating cyclophilin ligand interactor mutations in common variable immunodeficiency: clinical and immunologic outcomes in heterozygotes. J Allergy Clin Immunol 120: 1178-1185.

  20. López-Mejías R, del Pozo N, Fernández-Arquero M, Ferreira A, García-Rodríguez MC, et al. (2009) Role of polymorphisms in the TNFRSF13B (TACI) gene in Spanish patients with immunoglobulin A deficiency. Tissue Antigens 74: 42-45.

  21. von Bülow GU, van Deursen JM, Bram RJ (2001) Regulation of the T-independent humoral response by TACI. Immunity 14: 573-582.

  22. Yan M, Wang H, Chan B, Roose-Girma M, Erickson S, et al. (2001) Activation and accumulation of B cells in TACI-deficient mice. Nat Immunol 2: 638-643.

  23. Seshasayee D, Valdez P, Yan M, Dixit VM, Tumas D, et al. (2003) Loss of TACI causes fatal lymphoproliferation and autoimmunity, establishing TACI as an inhibitory BLyS receptor. Immunity 18: 279-288.

  24. Hymowitz SG, Patel DR, Wallweber HJ, Runyon S, Yan M, et al. (2005) Structures of APRIL-receptor complexes: like BCMA, TACI employs only a single cysteine-rich domain for high affinity ligand binding. J Biol Chem 280: 7218-7227.

  25. Wallweber HJ, Compaan DM, Starovasnik MA, Hymowitz SG (2004) The crystal structure of a proliferation-inducing ligand, APRIL. J Mol Biol 343: 283-290.

  26. Lee JJ, Jabara HH, Garibyan L, Rauter I, Sannikova T, et al. (2010) The C104R mutant impairs the function of transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI) through haploinsufficiency. J Allergy Clin Immunol 126: 1234-1241.

  27. Lee JJ, Rauter I, Garibyan L, Ozcan E, Sannikova T, et al. (2009) The murine equivalent of the A181E TACI mutation associated with common variable immunodeficiency severely impairs B-cell function. Blood 114: 2254-2262.

  28. Salzer U, Birmelin J, Bacchelli C, Witte T, Buchegger-Podbielski U, et al. (2007) Sequence analysis of TNFRSF13b, encoding TACI, in patients with systemic lupus erythematosus. J Clin Immunol 27: 372-377.

  29. Cassidy JT, Burt A, Petty R, Sullivan D (1969) Selective IgA deficiency in connective tissue diseases. N Engl J Med 280: 275.

  30. Cassidy JT, Kitson RK, Selby CL (2007) Selective IgA deficiency in children and adults with systemic lupus erythematosus. Lupus 16: 647-650.

  31. Rankin EC, Isenberg DA (1997) IgA deficiency and SLE: prevalence in a clinic population and a review of the literature. Lupus 6: 390-394.

  32. Suyama K, Kawasaki Y, Abe Y, Watanabe M, Ohara S, et al. (2012) Development of common variable immunodeficiency in IgA- and IgG2-deficient patients with systemic lupus erythematosus. Pediatr Nephrol 27: 489-492.

  33. Wang N, Hammarström L (2012) IgA deficiency: what is new? Curr Opin Allergy Clin Immunol 12: 602-608.

  34. Ferreira RC, Pan-Hammarström Q, Graham RR, Gateva V, Fontán G, et al. (2010) Association of IFIH1 and other autoimmunity risk alleles with selective IgA deficiency. Nat Genet 42: 777-780.

  35. Visentini M, Conti V, Cagliuso M, Tinti F, Siciliano G, et al. (2009) Regression of systemic lupus erythematosus after development of an acquired Toll-like receptor signaling defect and antibody deficiency. Arthritis Rheum 60: 2767-2771.

  36. Torres-Salido M, Cortés-Hernández J, Balada E, Tarrés MV, Ordi-Ros J (2011) Systemic lupus erythematosus as a first presentation of common variable immunodeficiency associated with infrequent mannose-binding lectin gene polymorphisms. Rheumatol Int 31: 537-541.

  37. Holbro A, Jauch A, Lardinois D, Tzankov A, Dirnhofer S, et al. (2012) High prevalence of infections and autoimmunity in patients with thymoma. Hum Immunol 73: 287-290.

Tables and Figures at a glance

Table icon Table icon Table icon
Table 1 Table 2 Table 3

 

Table icon Table icon Table icon
Table 4 Table 5 Table 6

 

Figures at a glance

Figure
Figure 1
Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 11597
  • [From(publication date):
    August-2014 - Nov 19, 2017]
  • Breakdown by view type
  • HTML page views : 7826
  • PDF downloads : 3771
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords