alexa Utilization of a Duplex HybProbe Real-Time PCR to Detect and Estimate IL-28B Polymorphisms Prevalence among HIV/HCV Co-infected Patients in Hong Kong | OMICS International
ISSN: 2161-0703
Journal of Medical Microbiology & Diagnosis
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Utilization of a Duplex HybProbe Real-Time PCR to Detect and Estimate IL-28B Polymorphisms Prevalence among HIV/HCV Co-infected Patients in Hong Kong

Sabrina Wai-Chi To1, Gilman Kit-Hang Siu2, Ka-Hing Wong3, Kenny Chi-Wai Chan3, King-Tai Yuen1, Hon-Man Ng1 and Wing-Cheong Yam1*

1Department of Microbiology, Queen Mary Hospital, The University of Hong Kong, Hong Kong, Special Administrative Region, China

2Department of Health Technology and Informatics, The Hong Kong Polytechnic University, Hong Kong, Special Administrative Region, China

3Integrated Treatment Centre, Special Preventive Programme, Centre of Health Protection, Department of Health, Hong Kong, Special Administrative Region, China

*Corresponding Author:
Dr. W.C. Yam
Department of Microbiology, Queen Mary Hospital
The University of Hong Kong, Hong Kong Special Administrative Region
China
Tel: +852-22554821
Fax: +852-28551241
E-mail: [email protected]

Received Date: June 01, 2015 Accepted Date: June 03, 2015 Published Date: June 06, 2015

Citation: To SWC, Siu GKH, Wong KH, Chan KCW, Yuen KT, et al. (2015) Utilization of a Duplex HybProbe Real-Time PCR to Detect and Estimate IL-28B Polymorphisms Prevalence among HIV/HCV Co-infected Patients in Hong Kong. J Med Microb Diagn 4:194. doi: 10.4172/2161-0703.1000194

Copyright: © 2015 To SWC, et al., This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Medical Microbiology & Diagnosis

Abstract

Conventional treatment for chronic HCV infection relies on the combination of peg-interferon and ribavirin therapy. Both interleukin-28B (IL-28B) polymorphisms and HCV genotypes serve as the strongest predictive values for therapeutic prognosis. The treatment regimens for HIV/HCV co-infected patients are more complex and dependent on various host immune and viral factors. A rapid and cost-effective IL-28B genotyping tool is therefore crucial to assist clinicians on better patient management. This study aimed to evaluate the performance of a newly developed HybProbe duplex real-time PCR assay in detecting IL-28B polymorphisms on rs12979860 and rs8099917, and to estimate the prevalence of IL-28B polymorphisms among HIV/HCV co-infected patients in Hong Kong. A total of 88 HIV/HCV co-infected patients were recruited at the Integrated Treatment Centre during 2009 to 2014. IL- 28B polymorphisms on rs12979860 and rs8099917 were determined by an in-house HybProbe assay with melting curve analysis. For assay evaluation, IL-28B polymorphisms of 46 samples with diverse HIV/HCV genotypes were confirmed by Sanger sequencing. Both in-house HybProbe assay and sequencing results for IL28B polymorphisms determination were completely concordant. Among the 88 HIV/HCV co-infected, the frequency of rs12979860 wildtype (C/C) was 88.6%, heterozygous mutant (C/T) was 9.1% and remaining 2.3% homozygous mutant (T/T). The prevalence of IL-28B polymorphisms in rs8099917 was slightly differed, which had 90.9% wild-type (T/T), 6.8% heterozygous mutant (G/T) and 2.3% homozygous mutant (G/G). This novel duplex assay could allow clinicians to make early decision on treatment option for HIV/HCV co-infected patients by detecting rs12979860 and rs8099917 polymorphisms simultaneously.

Background

In developed countries, the morbidity and mortality in Human Immunodeficiency Virus (HIV) patients is significantly induced by chronic Hepatitis C Virus (HCV) co-infection. It is estimated to have about one-third of HIV patients co-infected with HCV. These patients usually require immediate HCV treatment as they tolerate poorly towards antiretroviral treatment, progress more rapidly to end-stage liver disease and often lead to death [1,2].

For decades, the standard therapy for HCV infection relies on the combination of pegylated interferon and ribavirin (PEG-IFN/RBV). This treatment is known to be less effective towards HIV/HCV coinfected patients, with a lower rate of Sustained Virological Response (SVR) and a higher rate of viral relapse upon treatment completion [3,4]. Recent studies identified two Single Nucleotide Polymorphisms (SNPs) rs12979860 and rs8099917 that located near interleukin-28B (IL-28B) and acted as important baseline predictors for PEG-IFN/RBV treatment responses. Strong association between favourable genotypes (C/C for rs12979860 and T/T for rs8099917) and high rate of SVR were observed in several genome wide association studies [5-8].

Clinical management on HIV/HCV co-infected patients is always more complicated than mono-infected patients. Several commercial assays and sequencing are the major IL-28B polymorphisms detection methods, yet they are relatively expensive and time-consuming. This study aimed to develop a rapid and cost-effective duplex HybProbe real-time assay to detect both rs12979860 and rs8099917 SNPs in a single reaction and estimate the prevalence of IL-28B, HIV-1 and HCV subtypes among co-infected patients in this locality.

Objectives

To evaluate the performance of a newly developed HybProbe duplex real-time PCR assay in detecting IL-28B polymorphisms on rs12979860 and rs8099917, and to estimate the prevalence of IL-28B polymorphisms among HIV/HCV co-infected patients in Hong Kong.

Study Design

A total of 88 HIV/HCV co-infected patients were recruited at the Hong Kong Government Integrated Treatment Centre during 2009 to 2014. Whole blood samples were collected after patient consent. The IL-28B polymorphisms on rs12979860 and rs8099917 of all samples were detected by the HybProbe assay with melting curve analysis. The duplex PCR assay was amplified by LightCycler® FastStart DNA Master HybProbe (Roche Diagnostics, Germany), with two pairs of primers and hybridization probes specifically targeting rs12979860 and rs8099917 (Table 1). For assay evaluation, IL-28B polymorphisms of 46 samples were further confirmed by Sanger sequencing. HCV viral load was quantitated by Abbott m2000 RealTime HCV assay (Abbott Laboratories, USA) while HIV-1 and HCV genotypes were confirmed by our in-house methods [9,10]. Statistical analysis was performed by Graphpad Prism version 6(Graphpad software, California, US).

rs12979860
Forward Primer 5’-GCGCTTATCGCATACGGCTA-3’
Reverse Primer 5’-TCACAGAAGGGAGCCCTGCC-3’
Sensor Probe 5’-CGAAGGCGCGAACCAGG-Fluorescein-3’
Anchor Probe 5’- LC Red 640 - TGAATTGCTCCGCGCTCCC-Phosphate - 3’
rs8099917
Forward Primer 5’- AAGTAACACTTGTTCCTTGTAAAAGATTCC - 3’
Reverse Primer 5’- CGCTATAATTAAAGATGTGGGAGAATGCAA - 3’
Sensor Probe 5’ - CCTTTCTGTGAGCAATTTCACCCAA- Fluorescein - 3’
Anchor Probe 5’ - LC Red 705-TGGAACCATGCTGTATACAGTTTGGTAGC-Phosphate – 3’

Table 1: Primers and probes for IL-28B Genotyping assays.

Results

Basic demographic characteristics of HIV/HCV co-infected patients in this study are presented in Table 2. There were 82 males (93.2%) included in this study, with an overall median age at 39 (range 21 – 63 years). Nearly 65% of the study population were Chinese with approximately 33% non-Chinese Asians. The in-house HIV-1 genotyping analysis revealed that the patients were infected by subtype B (20.5%), CRF01_AE (47.7%) and C or BC recombinants (15.9%). HCV genotypes were detected in 71 patients, including genotype 1/1a/1b (30.7%), 3a/3b (26.1%) and 6a/6d/6e (23.9%). Due to low HIV-1 or HCV viral load at sample collection, about 15 – 20% of the co-infected patients were unable to have either or both viral genotyping results.

  Total rs12979860 P-value* rs8099917 P-value*
  n (%) CC CT/TT   TT TG/GG  
    (n=78) (n=10)   (n=80) (n=8)  
Gender       0.5260     0.4455
Male 82 (93.2) 73 (83.0) 9 (10.2)   75 (85.2) 7 (8.0)  
Female 6 (6.8) 5 (5.7) 1 (1.1)   5 (5.7) 1 (1.1)  
               
               
Ethnicity       0.7117     0.2572
Chinese 57 (64.8) 50 (56.8) 7 (8.0)   50 (56.8) 7 (8.0)  
Asian 29 (33.0) 27 (30.7) 2 (2.3)   28 (31.8) 1 (1.1)  
Undetermined 2 (2.3) 1 (1.1) 1 (1.1)   1 (1.1) 1 (1.1)  
               
Risk of Infection       N/A     N/A
IDU 18 (20.5) 17 (19.3) 1 (1.1)   17 (19.3) 1 (1.1)  
Homosexual 7 (8.0) 7 (8.0) --   7 (8.0) --  
Heterosexual 2 (2.3) 2 (2.3) --   2 (2.3) --  
Undetermined 61 (69.3) 52 (59.0) 9 (10.2)   54 (61.4) 7 (8.0)  
               
HIV-1 subtypes       0.0662     0.1006
B 18 (20.5) 13 (14.8) 5 (5.7)   14 (15.9) 4 (4.5)  
CRF01_AE 42 (47.7) 39 (44.3) 3 (3.4)   40 (45.5) 2 (2.3)  
C or CRF07_BC or
CRF08_BC
14 (15.9) 13 (14.8) 1 (1.1)   13 (14.8) 1 (1.1)  
   
PCR -ve 14 (15.9) 13 (14.8) 1 (1.1)   13 (14.8) 1 (1.1)  
               
               
HCV genotypes       0.1267     N/A
1 / 1a / 1b 27 (30.7) 26 (29.5) 1 (1.1)   27 (30.7) --  
3a / 3b 23 (26.1) 18 (20.5) 5(5.7)   18 (20.5) 3 (3.4)  
6a / 6d / 6e 21 (23.9) 19 (21.6) 2 (2.3)   20 (22.7) 1 (1.1)  
PCR -ve 17 (19.3) 15 (17.0) 2 (2.3)   15 (17.0) 2 (1.1)  

Table 2: Basic demographic characteristics of HIV/HCV co-infected patients.

The HybProbe assay performance was evaluated among 46 coinfected samples, using Sanger sequencing as gold standard. Diverse HIV-1 subtypes (5 subtype B, 3 subtype C, 29 CRF01_AE, 4 CRF07_BC, 1 CRF08_BC and 4 undetermined) and HCV genotypes (2 genotype 1, 9 genotype 1a, 6 genotype 1b, 2 genotype 3a, 1 genotype 3b, 9 genotype 6a, 1 genotype 6d, 3 genotype 6e and 13 undetermined) samples were included for evaluation. Sanger sequencing required two individual reactions and manual sequence proof-reading whereas in-house HybProbe assay required melting curve analysis to interpret the SNPs on rs12979860 and rs8099917. Rs12979860 C/C wild-type had a melting peak at 64°C ± 1°C while T/T mutant had a lower melting temperature at 54°C ± 1°C (Figure 1A). For rs8099917, T/T wild-type melted at 64°C ± 1°C whereas mutant G/G melted at 57°C ± 1°C (Figure 1B). Heterozygous mutants (C/T of rs12979860 and T/G of rs8099917) could be typically interpreted when both melting peaks of wild-type and mutant were seen. Both systems concordantly detected two C/T and one T/T mutants of rs12979860, as well as one G/T and one G/G mutants of rs8099917.

medical-microbiology-diagnosis-Melting-curves

Figure 1: Melting curves and melting peaks analysis of rs12979860 (Figure 1A) and rs8099917 (Figure 1B) single nucleotide polymorphisms detection by in-house HybProbe assay. Heterozygous mutants could be interpreted when both melting peaks or wild-type and mutant were seen.

Among the 88 HIV/HCV co-infected patients in this locality, the frequency of rs12979860 wild-type (C/C) was 88.6%, while the frequency of C/T and T/T mutants was 9.1% and 2.3% respectively. The prevalence of IL-28B polymorphisms is rs8099917 was significantly differed (P < 0.0001, Fisher's exact tests), which had 90.9% wildtype (T/T), 6.8% G/T and 2.3% G/G mutants. This study revealed no association between HIV-1 subtypes, HCV genotypes, ethnicities or gender between rs12979860 or rs8099917 unfavourable genotypes. Most of the patients had concordant wild-type or mutant genotypes between both rs12979860 and rs8099917. Exceptions were seen in one Asian and one patient with undetermined ethnicity as they had unfavourable C/T on rs12979860 but favourable wild-type T/T on rs8099917.

Discussion

The identification of both rs12979860 and rs8099917 favourable genotypes largely enhanced the rate of SVR in HIV/ HCV co-infected patients. To our knowledge, this is the first inhouse duplex IL-28B real-time HybProbe assay that successfully identifies both rs12979860 and rs8099917 SNPs simultaneously in one single tube. The HybProbe assay used LC-RED640 and LCRED705 acceptor dyes to detect both SNPs in a single run instead of individual sequencing reactions. The melting temperatures for both SNPs interpretation were also very distinct, which was 10°C for rs12979860 and 6°C for rs8099917, respectively. Traditional Sanger sequencing consists of several tedious experimental steps, including end-point PCR and capillary analysis, whereas the in-house duplex assay largely shortened the turnaround time from two days to two hours with at least 50% of running cost reduction.

The in-house HybProbe assay achieved 100% concordant SNPs interpretation with the sequencing results. Both Chinese and Asians were included in this study, together with diverse HIV-1 and HCV genotypes, suggesting that the current assay would be largely applicable to global laboratories. Both HIV-1 subtype B and CRF01_ AE accounted for about 80% of local infections in Hong Kong [11]. A higher prevalence of CRF01_AE (47.7%) was noticed in our patients, whereas the prevalence for subtype B was relatively low (20.5%). Limited information on routes of infection was available at the time of study, though about a-fifth of the study population were infected via intravenous drug use. Conversely the prevalence of HCV genotype 1, 3 and 6 were roughly similar, which was inconsistent with previous local studies, suggesting that the HIV/HCV co-infection might predominantly affect intravenous drug users with distinct epidemiological and transmission pattern. [10,12].

Clinical management among HIV/HCV co-infected patients usually induced more complications due to drug-drug interaction and patients’ immune status. Poor SVR rate was mainly associated with HCV genotype 1 and unfavourable IL-28B SNPs yet the information on other HCV genotypes and HIV co-infection was scarce. Two of our patients had C/T mutant on rs12979860 but wild-type T/T on rs8099917. Their treatment response towards 48-week of PEG-IFN/ RBV should be analysed in greater details to assess the impact of discordant IL-28B polymorphisms. Due to data availability, the HIV/ HCV treatment history and rate of SVR were insufficient for further investigation on the relationship between IL28B polymorphisms, HIV/HCV genotypes and treatment responses among HIV/HCV coinfected patients.

Conclusion

This study developed a simple and efficient IL28B duplex realtime HybProbe assay with excellent performance on rs12979860 and rs8099917 SNPs detection. The rapid detection allows clinicians to make early decision on treatment option and duration. Both C/C and T/T wild-types of rs12979860 and rs8099917 were prevalent in our locality. No significant association were observed between IL28B polymorphisms and HIV/HCV genotypes.

Acknowledgement

The study was supported by the AIDS Trust Fund of the Hong Kong Special Administrative Region Government (Grant MSS-220R). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

The authors are grateful to the nursing team and physicians of the Integrated Treatment Centre for their dedicated care of the patients. The opinions and assertions contained herein are private views of the authors and do not necessarily reflect those of the Centre for Health Protection, Department of Health, Hong Kong.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

  • 10th World Congress on Alzheimers Disease & Dementia
    May 30-31, 2018 Osaka, Japan
  • 4th World Congress and Exhibition on Antibiotics and Antibiotic Resistance
    June 14-15, 2018 Barcelona, Spain
  • 4th Annual Congress on Infectious Diseases  
    September 17-18, 2018 San Diego, USA
  • 13th World Congress on Virology
    September 26-27, 2018 Montreal, Canada

Article Usage

  • Total views: 11727
  • [From(publication date):
    September-2015 - Dec 16, 2017]
  • Breakdown by view type
  • HTML page views : 7951
  • PDF downloads : 3776
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]ne.com

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version