alexa Vancomycin Resistant Staphylococcus aureus from Clinical Isolates in Zaria Metropolis, Kaduna State

Clinical Infectious Diseases: Open Access

  • Research Article   
  • Clin Infect Dis 2018, Vol 2(1): 105

Vancomycin Resistant Staphylococcus aureus from Clinical Isolates in Zaria Metropolis, Kaduna State

Garba S1*, Igwe JC2, Onaolapo JA1 and Olayinka BO1
1Department of Pharmaceutics and Pharmaceutical Microbiology, Ahmadu Bello University, Zaria, Nigeria
2Department of Pharmaceutics and Pharmaceutical Microbiology, Kaduna State University, Kaduna, Nigeria
*Corresponding Author: Garba S, Department of Pharmaceutics and Pharmaceutical Microbiology, Ahmadu Bello University, Zaria, Nigeria, Tel: +23408034842392, Email: [email protected]

Received Date: Mar 28, 2018 / Accepted Date: Apr 07, 2018 / Published Date: Apr 14, 2018

Abstract

Vancomycin antibiotic is a well-known drug of last resort in the treatment of methicillin-resistant S. aureus (MRSA), but recent studies have shown the emergence of resistance to vancomycin and other antibiotics. This study determines the phenotypic and genotypic prevalence of vancomycin resistant S. aureus (VRSA) among clinical isolates in Zaria Metropolis. A total of 350 suspected Staphylococcal isolates from clinical specimens (blood, urine, high vaginal swab, wound swab, ear swab, urethral swab) submitted to the Medical Microbiology Unit of the selected hospitals in Zaria were collected for the period of 6 months. The antibiotic susceptibility profile of MRSA isolates were determined using disc diffusion method while the minimum inhibitory concentration (MIC) for vancomycin was determined using Etest® gradient method. PCR and sequencing were conducted on the isolates to molecularly detect the presence of mecA and van genes (vanA, vanB, vanC, vanD, vanR and vanXY). Phenotypic VRSA evaluation showed that 3.92% of S. aureus isolates were VRSA, 19.6% of isolates were VISA (vancomycin intermediate S. aureus) and 76.47% of isolates were VSSA (vancomycin susceptible S. aureus). Twelve (12) isolates that had vancomycin MIC range of 4-16 μg/ml were selected for genotypic evaluation of virulent genes. All isolates amplified with 16SrRNA signifying all are S. aureus. The result shows that 58% of the isolates harbors mecA gene, 25% of isolates harbors vanA gene, 67% vanB gene, 41.7% vanC, 58.3% vanD, 83.3% vanR and 83.3% vanXY. The presence of van gene was implicated in generation of Vancomycin resistance isolates.

Keywords: Staphylococcus aureus; Vancomycin resistance; Clinical isolates

Introduction

The emergence of methicillin resistant Staphylococcus aureus and its multidrug resistant profile has put pressure on agents to treat the organism [1]. The treatment of the MRSA infections has become problematic because of the emergence of resistance to vancomycin and other antibiotics, which were effective against MRSA. In clinics, determination of the anti-microbial susceptibility of an isolate is crucial for an optimal therapy [2]. Vancomycin has been considered the mainstay of therapy for infections associated with methicillin-resistant S. aureus (MRSA) as well as infections due to methicillin-susceptible S. aureus (MSSA) in patients with intolerance to beta-lactam antibiotics [3]. However the increase use of vancomycin has led to the emergence of various vancomycin resistance phenotypes and to the consequent reduction in its efficacy against MRSA in the clinical environment [4]. Various vancomycin resistance phenotypes includes VISA(vancomycin-intermediate S. aureus), hVISA (heterogenous vancomycin-intermediate S. aureus), VRSA(Vancomycin-resistant S. aureus) S. aureus strains are defined to be vancomycin resistant(VRSA) at minimum inhibitory concentration (MIC) ≥ 16 μg/ml and vancomycin intermediate S. aureus (VISA) at MIC between 4-8 μg/ml by the Clinical and Laboratory Standards Institute (CLSI 2014). Also, the MIC for heterogenous VISA (hVISA) strains was defined by the presence of subpopulations of VISA at a rate of 1 organism per 105 to 106 organisms [5]. Some case reports had found VRSA in absence of Vancomycin exposure (Whitener, 2003). The increasing prevalence of VRSA is a threat to clinical medicine. Sepsis and other infection caused by Vancomycin resistant strains are very difficult to manage and as there are few options left available to deal with VRSA [6]. Therefore, present study will be conducted to determine the extent of Vancomycin resistance in this locality.

Material and Methods

Study area

The study was carried out using three selected hospitals within Zaria metropolis. The following hospitals were selected for this study base on patients’ population, distance apart, good representation of Zaria metropolis: Gambo Sawaba General Hospital Kofangayan, (MIBA) Major Ibrahim B. Abdullahi memorial hospital Sabon Gari Zaria, St. Luke Anglican Hospital Wusasa Zaria, Kaduna State.

Sample size

Sample size was calculated using sampling technique [7] and approximately 350 specimens was used for the research.

Collection of isolates

A total of three hundred and fifty (350) suspected Staphylococcal spp. isolated from clinical specimens (blood, urine, high vaginal swab, wound swab, ear swab, urethral swab) submitted to the laboratory of the selected hospitals were collected over a period of 3 months and transported in a sterile ice park to Pharmaceutical Microbiology laboratory, A.B.U, Zaria.

Identification of S. aureus isolates

Microgen Staphylococcus identification kit (bioMerieux, Inc, Durham, USA) was used to identify the S. aureus isolates. The procedures were carried out according to the manufacturer’s instructions.

Antibiotic susceptibility test

Kirby-Bauer Disk diffusion method was employed to perform antibiotics susceptibility test for each of the isolates previously identified as Staph. aureus and result interpreted by the Clinical Laboratory Standard Institute. List of antibiotics used are: Cefoxitin (30 μg), Vancomycin (30 μg), Chloramphenicol (30 μg), Amoxicillin (30 μg), Gentamicin (10 μg), Ciprofloxacin (5 μg), Teicoplanin (30 μg), Erythromycin (15 μg), oxacillin (30 μg), Clindamycin (30 μg) and Cefixime (30 μg) (Oxoid Ltd.).

Determination of Multiple Antibiotics Resistance (MAR) index

The Multiple Antibiotic Resistance (MAR) index was determined for each isolate by dividing the number of antibiotics to which the organisms are resistant to by the total number of antibiotics tested (Figure 1) [8,9].

clinical-infectious-diseases-Occurrence-VRSA

Figure 1: Occurrence of VRSA among S. aureus isolated from hospitals in Zaria.

image

Determination of minimum inhibitory concentration (MIC) of vancomycin using vancomycin MIC strip

All isolates were tested with Vancomycin MIC Evaluator strip (Oxoid) on Mueller-Hinton agar plates (Figures 2-9). For each isolates a bacterial suspension adjusted to 0.5 McFarland standards were used. The zones of inhibition were read after 24 hours incubation at 37°C.

clinical-infectious-diseases-Electrophoretic-gel

Figure 2: Electrophoretic gel of Staph A (301bp) amplified from S. aureus isolates.

clinical-infectious-diseases-gel

Figure 3: Electrophoretic gel of mecA (532bp) amplified from S. aureus isolates.

clinical-infectious-diseases-isolates

Figure 4: Electrophoretic gel of vanA (732bp) amplified from Staphylococcus aureus isolates.

clinical-infectious-diseases-Electrophoretic

Figure 5: Electrophoretic gel of vanB (635bp) amplified from Staphylococcus aureus isolates.

clinical-infectious-diseases-amplified

Figure 6: Electrophoretic Gel of vanC (822bp) amplified from Staphylococcus aureus isolates.

clinical-infectious-diseases-Electrophoretic

Figure 7: Electrophoretic gel of vanD (439bp) amplified from Staphylococcus aureus isolates.

clinical-infectious-diseases-gel

Figure 8: Electrophoretic gel of vanR (645bp) Amplified from S. aureus isolates.

clinical-infectious-diseases-isolates

Figure 9: Electrophoretic gel of vanXY (543bp) amplified from S. aureus isolates.

Bacteria cell preparation

The preparation of the bacteria cell was carried out using the method described by [10]. An overnight culture of the bacteria isolates were cultured in LB broth for 48 h. This is to ensure increased cell mass and yield.

DNA extraction

Genomic DNA extraction was carried out using the method described by ZymogenR manufacturer protocols.

Detection of resistant gene using primers by PCR

mecA and van genes (vanA, vanB, vanC, vanD, vanX, vanXY, vanR) [11,12] including 16SrRNA [13] primers were used for PCR. PCR was performed with the following thermal settings conditions: 5 min at 94°C for initial enzyme activation, followed by 40 cycles of amplification consisting of denaturation at 94°C for 30s for mecA and 1 min for van genes, annealing at 57°C for 45s for mecA and at 55°C for 1 min for van genes, and extension at 72°C for 30 s for mecA and 2 min for van genes, with a final extension at 72°C for 5 min (Table 1) [14].

Primer Forward Reverse Bp Reference
16SrRNA AATCTT TGTCGG TAC ACG ATATTCTTC ACG CGTAATGAG ATT TCA GTA GAT AATACA ACA 107 Martineau et al. [13]
mecA AAA ATCGAT GGTAAA GGT TGGC AGT TCT GCA GTACCG GAT TTG C 532 Strommenger et al. [11]
vanA GGGAAAACGACAATTGC GTACAATGCGGCCGTTA 732 Nicole et al. [12]
vanB ATGGGAAGCCGATAGTC GATTTCGTTCCTCGACC 635  
vanC GGTATCAAGGAAACCTC CTTCCGCCATCATAGCT 822  
vanD CTCCTACGATTCTCTTG CGAGCAAGACCTTTAAG 439  
vanXY AATAGCTATTTTGATTTCCCCGTTA TCCTGAGAAAACAGTGCTTCATTAA 543  
vanR AGCGATAAAATACTTATTGTGGA CGGATTATCAATGGTGTCGTT 645 Anahita et al. [19]

Table 1: Primers sequence and base pair.

Results

Occurrence of S. aureus among the collected isolates from the Hospitals

A total of 350 isolates were collected from three Hospitals in Zaria and were analyzed for S. aureus. The prevalence of S. aureus in this study was observed to be 14.6% of the suspected Staphylococcal isolates collected. HGSGH had the highest occurrence of S. aureus (20.67% (31)), followed by MIBA [11% (11)] while SLAH had the least occurrence (Table 2).

Hospital No. of Isolates screened No of S. aureus isolated % Prevalence of S. aureus
SLAH 100 11 11.00
MIBA 100 9 9.00
HGSGH 150 31 20.67
Total 350 51 14.6

Table 2: Occurrence of S. aureus among presumed Staphylococci isolates from the hospitals.

Keys: SLAH=St. Luke Anglican Hospital. Wusasa, MIBA=Major Ibrahim B. Abdullahi memorial hospital Sabon Gari Zaria, HGSGH= Hajiya Gambo Sawaba General Hospital, Kofan-Gayan.

Distribution of S. aureus isolates by source

Base on sample source, HVS (39%) and urine (31%) samples had the highest occurrence of S. aureus followed by wound (17%) and Ear swabs (9.8%) samples while Urethral swab had the least occurrence of S. aureus (2%) (Table 3).

S/No SOURCE  NUMBER (%)
1 High Vagina Swab 20 (39%)
2 Urine 16 (31%)
3 Wound 9 (17%)
4 Ear Swab 5 (9.8%)
5 Urethral Swab 1 (2%)
  TOTAL 51

Table 3: Distribution of S. aureus isolates by source.

Antibiotics susceptibility profile of S. aureus isolates

The isolates were susceptible to Gentamycin (96.1%), Chloramphenicol (82.4%), Ciprofloxacin (78.4%), Vancomycin (76.5%), Erythromycin (58.8%) and Teicoplanin (52.9%), while resistant to Cefoxitin (98%), Cefixime (100%), Amoxicillin (100%) and Oxacillin (100%) as shown in (Table 4).

S/No Antibiotic (µg) Sensitive (%) Intermediate (%) Resistant (%)
1 Vancomycin (30) 39 (76.5) 0 (0) 12 (23.5%)
2 Tecoiplanin (30) 27 (52.9) 18 (35.3) 6 (11.8%)
3 Erythromycin (15) 30 (58.8) 8 (17.6) 13 (23.5%)
4 Gentamycin (30) 49 (96.1) 0 (0) 2 (3.92%)
5 Amoxicillin (10) 0 (0) 0 (0) 51 (100%)
6 Chloramphenicol (30) 42 (82.4) 3 (5.9) 6 (11.8%)
7 Cefoxitin (30) 1 (1.96) 0 (0) 50 (98%)
8 Clindamycin (2) 18 (35.3) 21 (43.1) 12 (21.63%)
9 Ciprofloxacin (5) 40 (78.4) 2 (3.9) 9 (17.65%)
10 Oxacillin (30) 0 (0) 0 (0) 51 (100%)
11 Cefixime (30) 0 (0) 0 (0) 51 (100%)

Table 4: Antibiotics susceptibility profile of S. aureus isolates.

Multiple antibiotic resistance (MAR) index of isolates

The multiple antibiotic resistant indexes (MARI) for each of the 51 isolates were determined as:

image

MARI showed that all 51 (100%) isolates were resistant to three or more antibiotics. MARI ≥ 0.3 indicated that the isolates originated from an environment where antibiotics were frequently used. Two isolates showed 90% resistance to the eleven antibiotics tested. All the isolates were consistently resistant to amoxicillin, cefixime and oxacillin (Table 5).

No. of antibiotic to which resistant Resistant isolates MAR index % of S. aureus to MARI
1 0 0 0
2 0 0.1 0
3 1 0.2 1.96
4 14 0.3 27.45
5 21 0.4 41.17
6 10 0.5 19.6
7 1 0.6 1.96
8 1 0.7 1.96
9 1 0.8 1.96
10 2 0.9 3.92
11 0 1.0 0

Table 5: Multiple Antibiotic Resistance (MAR) index of isolates.

Phenotypic prevalence of VRSA among S. aureus isolates

The result shows that the MIC (minimum inhibitory concentration) obtained for 51 isolates of S. aureus, 39 (76.5%) were susceptible to vancomycin, 10 (19.6%) were intermediate resistant to vancomycin and 2 (3.9%) were totally resistant to vancomycin, as shown in Figure 1.

Molecular characterization of antibiotic resistant genes in isolated S. aureus

Molecular characterization of Staph A 30 (16S rRNA)

Molecular detection of Staph A 30 (16S rRNA) was carried out using the specific primers for chromosomal fragment of Staphylococcus aureus. This study revealed that all isolates on gel electrophoresis in the DNA extracted were Staphylococcus aureus (Figure 2).

Keys: Lane 1=1 kb DNA ladder, Lane 2=U8, Lane 3=U12, Lane 4=W18, Lane 5=U53, Lane 6=W19, Lane 7=U5, Lane 8=U4, Lane 9=U9, Lane 10=HVS2, Lane 11=SBU10, Lane 12=U45, Lane 13=W17.

Molecular characterization of mecA gene

Molecular detection of mecA gene revealed that only 7 (58%) of the isolates amplified with mecA gene on agarose gel electrophoresis. Hence amplification on Lane 3, 4, 9, 10, 11, 12 and 13 (Figure 3)

Keys: Lane 1=1 kb DNA ladder, Lane 2= U8, Lane 3=U12, Lane 4=W18, Lane 5=U53, Lane 6=W19, Lane 7=U5, Lane 8=U4, Lane 9=U9, Lane 10=HVS2, Lane 11=SBU10, Lane 12=U45, Lane 13=W17.

Molecular characterization of vanA gene

Molecular detection of vanA gene revealed that only 3 (25%) of the isolates amplified with vanA gene on agarose gel electrophoresis. Hence amplification on Lane 5, 7 and 13 (Figure 4).

Keys: Lane 1=1 kb DNA ladder, Lane 2= U8, Lane 3=U12, Lane 4=W18, Lane 5=U53, Lane 6=W19, Lane 7=U5, Lane 8=U4, Lane 9=U9, Lane 10=HVS2, Lane 11=SBU10, Lane 12=U45, Lane 13=W17.

Molecular characterization of vanB gene

Molecular detection of vanB generevealed that only 8(67%) of the isolates amplified with vanB gene on agarose gel electrophoresis. Hence amplification on Lane 2, 3, 4, 5, 8, 10, 12 and 13 (Figure 5).

Keys: Lane 1=1 kb DNA ladder, Lane 2= U8, Lane 3=U12, Lane 4=W18, Lane 5=U53, Lane 6=W19, Lane 7=U5, Lane 8=U4, Lane 9=U9, Lane 10=HVS2, Lane 11=SBU10, Lane 12=U45, Lane 13=W17.

Molecular characterization of vanC gene

Molecular detection of vanC gene revealed that only 5(41.7%) of the isolates amplified with vanC gene on agarose gel electrophoresis. Hence amplification on Lane 2, 3, 6, 7 and 13 (Figure 6).

Keys: Lane 1=1 kb DNA ladder, Lane 2= U8, Lane 3=U12, Lane 4=W18, Lane 5=U53, Lane 6=W19, Lane 7=U5, Lane 8=U4, Lane 9=U9, Lane 10=HVS2, Lane 11=SBU10, Lane 12=U45, Lane 13=W17.

Molecular characterization of vanD gene

Molecular detection of vanD gene revealed that only 7(58.3%) of the isolates amplified with vanD gene on agarose gel electrophoresis. Hence, amplification on Lane 3, 4, 5, 6, 8 (Figure 7).

Keys: Lane 1=1 kb DNA ladder, Lane 2= U8, Lane 3=U12, Lane 4=W18, Lane 5=U53, Lane 6=W19, Lane 7=U5, Lane 8=U4, Lane 9=U9, Lane 10=HVS2, Lane 11=SBU10, Lane 12=U45, Lane 13=W17.

Molecular characterization of vanR gene

Molecular detection of vanR gene revealed that only 10 (88.3%) of the isolates were positive for vanR gene on agarose gel electrophoresis. Hence amplification on Lane 2, 3, 4, 6, 7, 9, 10, 11, 12 and 13 (Figure 8).

Keys: Lane 1=1 kb DNA ladder, Lane 2= U8, Lane 3=U12, Lane 4=W18, Lane 5=U53, Lane 6=W19, Lane 7=U5, Lane 8=U4, Lane 9=U9, Lane 10=HVS2, Lane 11=SBU10, Lane 12=U45, Lane 13=W17.

Molecular characterization of vanXY gene

Molecular detection of vanXY gene revealed that only 10 (88.3%) of the isolates were positive for vanXY gene on agarose gel electrophoresis. Hence amplification on Lane 2, 3, 4, 5, 6, 7, 8, 9, 10 and 12 (Figure 9).

Keys: Lane 1=1 kb DNA ladder, Lane 2= U8, Lane 3=U12, Lane 4=W18, Lane 5=U53, Lane 6=W19, Lane 7=U5, Lane 8=U4, Lane 9=U9, Lane 10=HVS2, Lane 11=SBU10, Lane 12=U45, Lane 13=W17.

Percentage occurrence of virulent genes

The percentage of occurrence for vancomycin resistant genes detected is presented below in (Table 6).

Primers Number (%)
MecA 7 (58)
vanA 3 (25)
VanB 8 (67)
VanC 5 (41.7)
VanD 7  (58)
VanR 10 (83.3)
VanXY 10 (83.3)

Table 6: Percentage occurrence of virulent genes.

Discussion

The rate of resistant strains occurrence is associated to lack of strict measures in the use of antibiotics in these hospitals by both health practitioners and the community. It is a well-known fact that development of antibiotics resistance in most organisms is associated with unjustified, irrational and irregular use of antibiotics by the human population, over the counter accessibility without recommendations and unrestricted use of antimicrobials in poultry, farm animals, and fisheries [15]. This study shows that phenotypic occurrence of VISA isolates is more than VRSA and this agrees with the study of [16], who reported that higher rate of VISA occurred than VRSA. VRSA reports in this study agrees with the study of [17] who reported phenotypic occurrence of VRSA in southern parts of Nigeria ranging from 0% to 6% among clinical isolates. But contrary to the reports of [18] who reported phenotypic prevalence rate of VRSA to be 57.7% in Zaria using disc methods. Though disc method is sometime not reliable, further finding are recommended to validate the superiority of MIC strip over disc method. Further evaluation of the findings of this study showed that the twelve (12) isolates that were multidrug resistant and exhibited either VISA or VRSA phenotypically, expressed three or more of the vancomycin resistant determinant genes (mecA, vanA, vanB, vanC, vanD, vanR and vanXY). This is in line with the reports of [19-21] who reported the expression of more than one of these genes in the isolates tested. However, there are limited reports on expression of vanXY in S. aureus. The carriage of van genes by intermediate resistance isolates [21] and none expression of the van genes [22] have been reported. Other reports supporting the findings of this study suggest that isolates with vanA gene expresses high level of resistance while isolates with VanB gene exhibits variable resistance to most antibiotics tested. More so, carriage of vanC and vanXY signifies low resistance while vanD shows moderate resistance [23-26]. Nevertheless some of the isolates that were vancomycin resistant are still susceptible to other antibiotics like gentamicin, chloramphenicol, ciprofloxacin and erythromycin. This could be as a result of adaptation to a tailored resistant mode, which give other antibiotic with different mechanism of action advantage over then. Some Case reports have also found VRSA in the absence of Vancomycin exposure [19,21] which is similar to this study. Vancomycin antibiotic are rarely used in the hospitals where the isolates were obtained, however the current study has exposed the presence of phenotypic and genotypic vancomycin resistant S. aureus strains in these hospitals. This might be an indication that a large proportion of the bacteria isolates have been pre-exposed to several antibiotics, and also, may be due to a combination of microbial characteristics such as selective pressure on antimicrobial usage, societal and technological changes that enhance the transmission of drug resistant organisms [26]. Other reasons could be due to increase in irrational consumption of antibiotics and transmission of resistant isolates between people [9]. It has therefore become necessary for further surveillance studies to be performed especially in this locality where there is limited documentations of procedures and preservation of clinical data. Due to the presence of VRSA in this locality, it is however necessary to impose restrictions on the use of the available antibiotics and other prescription drugs, to patients in both hospitals and community practice and to develop new drugs to combat the menace of multidrug failure.

Conclusion/Recommendation

This study has exposed the presence of Vancomycin resistant S. aureus encoding genes other than vanA gene in hospitals where vancomycin is rarely used, and also show cases limited reports on the prevalence of van resistant genes in our environment. The presence of these other cluster genes (vanB, vanC, vanD, vanR and vanXY) exhibited high level of resistance to the antibiotics tested. It has therefore become necessary for further periodic surveillance studies to be performed in this locality and to impose restrictions on prescriptions and abuse of available antibiotics by patients and professionals in both hospitals and community practice.

Ethical Approval

Ethical clearance was obtained from Ethical committee of the Ministry of health, Kaduna State.

Conflict of Interest

The authors declare that they have no conflict of interest on the findings reported in this study.

Reference

Citation: Garba S, Igwe JC, Onaolapo JA, Olayinka BO (2018) Vancomycin Resistant Staphylococcus aureus from Clinical Isolates in Zaria Metropolis, Kaduna State. Clin Infect Dis 2: 105.

Copyright: © 2018 Garba S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Select your language of interest to view the total content in your interested language

Post Your Comment Citation
Share This Article
Recommended Conferences
Article Usage
  • Total views: 91
  • [From(publication date): 0-2018 - May 26, 2018]
  • Breakdown by view type
  • HTML page views: 73
  • PDF downloads: 18

Post your comment

captcha   Reload  Can't read the image? click here to refresh
Leave Your Message 24x7