alexa Phylogenetic Analyses of the Genus Hymenobacter and Description of Siccationidurans gen. nov., and Parahymenobacter gen. nov | OMICS International | Abstract
ISSN: 2329-9002

Journal of Phylogenetics & Evolutionary Biology
Open Access

OMICS International organises 3000+ Global Conferenceseries Events every year across USA, Europe & Asia with support from 1000 more scientific Societies and Publishes 700+ Open Access Journals which contains over 50000 eminent personalities, reputed scientists as editorial board members.

Open Access Journals gaining more Readers and Citations

700 Journals and 15,000,000 Readers Each Journal is getting 25,000+ Readers

This Readership is 10 times more when compared to other Subscription Journals (Source: Google Analytics)

Research Article

Phylogenetic Analyses of the Genus Hymenobacter and Description of Siccationidurans gen. nov., and Parahymenobacter gen. nov

Gundlapally Sathyanarayana Reddy*
CSIR-Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad-500 007, India
Corresponding Author : Gundlapally Sathyanarayana Reddy
CSIR-Centre for Cellular and Molecular Biology
Uppal Road, Hyderabad-500 007, India
Tel: 91-40- 27192509
E-mail: [email protected]
Received September 04, 2013; Accepted October 17, 2013; Published October 25, 2013
Citation: Sathyanarayana Reddy G (2013) Phylogenetic Analyses of the Genus Hymenobacter and Description of Siccationidurans gen. nov., and Parahymenobacter gen. Nov. J Phylogen Evolution Biol 1: 122. doi: 10.4172/2329-9002.1000122
Copyright: © 2013 Sathyanarayana Reddy G. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Related article at
DownloadPubmed DownloadScholar Google

Abstract

Phylogenetic analyses of 26 species of the genus Hymenobacter based on the 16S rRNA gene sequences, resulted in polyphyletic clustering with three major groups, arbitrarily named as Clade1, Clade2 and Clade3. Delineation of Clade1 and Clade3 from Clade2 was supported by robust clustering and high bootstrap values of more than 90% and 100% in all the phylogenetic methods. 16S rRNA gene sequence similarity shared by Clade1 and Clade2 was 88 to 93%, Clade1 and Clade3 was 88 to 91% and Clade2 and Clade3 was 89 to 92%. Based on robust phylogenetic clustering, less than 93.0% sequence similarity, unique in silico restriction patterns, presence of distinct signature nucleotides and signature motifs in their 16S rRNA gene sequences, two more genera were carved to accommodate species of Clade1 and Clade3. The name Hymenobacter, sensu stricto, was retained to represent 17 species of Clade2. For members of Clade1 and Clade3, the names Siccationidurans gen. nov. and Parahymenobacter gen. nov. were proposed, respectively, and species belonging to Clade1 and Clade3 were transferred to their respective genera. The genera Hymenobacter (sensu stricto), Siccationidurans gen. nov. and Parahymenobacter gen. nov. contained the signature motifs AAGGCTTTCTGAGTCGTAAA (414-432), TGACGGTACCTGAGGAATAA (480-499) and ATTAATACCGCATAACACT (168-185) in their 16S rRNA gene sequences, respectively. Further, the genus Hymenobacter was emended and proposed a more acceptable genus description.

Keywords

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version