alexa TLR6 Gene Polymorphism And Its Effect On Economic Traits In Swine | 20275
ISSN: 2157-7579

Journal of Veterinary Science & Technology
Open Access

Like us on:

OMICS International organises 3000+ Global Conferenceseries Events every year across USA, Europe & Asia with support from 1000 more scientific Societies and Publishes 700+ Open Access Journals which contains over 50000 eminent personalities, reputed scientists as editorial board members.

Open Access Journals gaining more Readers and Citations
700 Journals and 15,000,000 Readers Each Journal is getting 25,000+ Readers

This Readership is 10 times more when compared to other Subscription Journals (Source: Google Analytics)

2nd International Conference on Animal & Dairy Sciences

Nandani Kumari, L B Singh, Subodh Kumar, Saroj Thakur and Kiran Kumari
Accepted Abstracts: J Veterinar Sci Technolo
DOI: 10.4172/2157-7579.S1.007
The present study was conducted to see the effect of TLR 6 polymorphism on different economic traits of swine. DNA was extracted from 50 pigs from pig unit, AICRP, RVC, BAU, Ranchi, Jharkhand. Primers, forward (GCAGCTGACGGTTTTGAGA) and reverse sequences (GGGATGGCACAAGATTGTCT) of amplified fragment size 553 were used to amplify the pig genomic DNA. Polymorphisms were seen at the locus by SSCP technique, performed on the same amplified product. Total 6 haplotypes (namely A, B, C, D, E and F) were obtained. Observations were recorded for litter size at birth (lszB), litter weight at birth (LwtB), litter size at weaning (LszW), Litter weight at weaning (LwtW), Body weight at Birth (BirthBdwt), Weight at 7 days (7daywt), body weight at 14 days (14daywt), body weight at 28 days (28daywt), body weight at 42 days (42daywt) and body weight at 56 days (56daywt) for the selected 50 pigs. Analysis using least square Harvey?s model was done with SPAB software to find the effect of haplotypes on the factors enlisted above. Results showed that out of all the factors, obtained haplotypes had significant effect on body weight at birth. In all other cases the effect was non-significant. In case of BirthBdwt, hap. D had maximum value with mean 1.3649?00.1960 and hap. F had minimum value with mean 01.0275?00.1492 with significant difference (P< 0.01) to each other. The study on TLR 6 gene, association with these traits was crucial to find its effect on other traits establishing the fact that it plays very vital role in innate immunity and hence further studies on the same aspect can be very helpful in marker assisted selection for disease resistance and that could be exploited for breeding strategies in swine.
Nandani Kumari is currently in 6 th semester of PhD. She has been a good student with merit scholarship holder throughout BVSc. Her work during MVSc was also on molecular genetics. She has cleared CSIR as well as ICAR NET. She cleared ARS Prelims as well as Mains-2013.A distinction holder throughout her studies till date, she has a penchant for research and teaching. She feels that it? s a beginning and she has a long way to go.
image PDF   |   image HTML
Peer Reviewed Journals
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

+1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals


[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version