alexa cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid.
Biomedical Sciences

Biomedical Sciences

Journal of Biomolecular Research & Therapeutics

Author(s): Skriver K, Olsen FL, Rogers JC, Mundy J

Abstract Share this page

Abstract We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.
This article was published in Proc Natl Acad Sci U S A and referenced in Journal of Biomolecular Research & Therapeutics

Relevant Expert PPTs

Recommended Conferences

Relevant Topics

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords