alexa Putative DNA quadruplex formation within the human c-kit oncogene.
Bioinformatics & Systems Biology

Bioinformatics & Systems Biology

Journal of Proteomics & Bioinformatics

Author(s): Rankin S, Reszka AP, Huppert J, Zloh M, Parkinson GN,

Abstract Share this page

Abstract The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.
This article was published in J Am Chem Soc and referenced in Journal of Proteomics & Bioinformatics

Relevant Expert PPTs

Relevant Speaker PPTs

Recommended Conferences

  • 9th International Conference on Bioinformatics
    October 23-24, 2017 Paris, France
  • 9th International Conference and Expo on Proteomics
    October 23-25, 2017 Paris, France

Relevant Topics

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords