alexa Study of a Family Presenting Novel Mutation of the TCOF1 Gene Associated with Treacher Collins Syndrome | Open Access Journals
ISSN: 2157-7412
Journal of Genetic Syndromes & Gene Therapy
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Study of a Family Presenting Novel Mutation of the TCOF1 Gene Associated with Treacher Collins Syndrome

Dell’Edera Domenico1*, Tinelli Andrea3, Pacella Elena6, Malvasi Antonio2, Novelli Antonio4, Conte Chiara4, Bertoli Marta4, Alesi Viola4, Monti Condesnitt Vito5 and Epifania Annunziata Anna1

1Unit of Cytogenetic and Molecular Genetics, Madonna delle Grazie Hospital, Matera, Italy

2Obstetric and Gynecology, Department Santa Maria Hospital, Bari, Italy

3Obstetric and Gynecology, Department V. Fazzi Hospital, Lecce, Italy

4Unit of Medical Genetics, San Pietro FBF Hospital, Rome, Italy

5Local Public Health, Taranto, Italy

6Department of Ophthalmology, University of Rome, Rome, Italy

*Corresponding Author:
Domenico Dell’Edera
Unit of Cytogenetic and Molecular Genetics
Madonna delle Grazie Hospital
Matera, 75100 Matera, Italy
Tel: +39 0835253439
Fax: +39 0835253863
E-mail: [email protected]

Received date: May 15, 2012; Accepted date:June 28, 2012; Published date: July 10, 2012

Citation: Domenico D, Andrea T, Elena P, Antonio M, Antonio N, et al. (2012) Study of a Family Presenting Novel Mutation of the TCOF1 Gene Associated with Treacher Collins Syndrome. J Genet Syndr Gene Ther 3:117. doi:10.4172/2157-7412.1000117

Copyright: © 2012 Domenico D, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Genetic Syndromes & Gene Therapy

Abstract

Treacher Collins syndrome (TCS), due to a mutation in the treacle gene (5q31-32), is the most common type of Mandibulofacial Dysostosis (MDF). The most important features of the considered diseases are hypoplasia, micrognathia, microtia, conductive hearing loss, and cleft palate. In this paper molecular and clinical analysis in a family with several members affected by MFD are reported. Clinical signs as well as inheriting pattern have been considered to reach a correct diagnosis. As genealogic tree showed Autosomic Dominant pattern (AD), Autosomic recessive diseases were not considered in different diagnosis. Furthermore, pathognomonic signs drew us to focus the attention on the possibility that Treacher Collins Syndrome occurred.The molecular research of gene TCOF1 confirmed the presence of a mutation that have never been described in literature before now (c.599delG.). MFD occurs in clinical and genetic different typologies of diseases, and in most cases a certain diagnosis can be reached by means of molecular genetics analysis

Keywords

Mandibulofacial Dysostosis (MFD); Treacher Collins Syndrome (TCS); Orofacial features

Introduction

Mandibulofacial Dysostosis (MDF) concerns a genetically heterogeneous group of disorders characterized by abnormal craniofacial development that is not associated with any limb anomalies [1].

Treacher-Collins syndrome (TCS; OMIM#154500) or Franceschetti-Klein Syndrome is the most common form of MFD [2]. The incidence of TCS is about 1 in 50.000 newborns [3], it has autosomal dominant inheritance and high penetrance (90%).

TCOF1 are a de novo event in about 50-60% of cases, while in 40-50% of cases are maternally or paternally inherited [4]. Clinical and molecular analysis developed on a family where three members have been affected by TCOF1 are reported. Clinical examination on members of the above mentioned family suggested TCS. TCOF1 molecular analysis highlighted a mutation never described in literature, confirming clinical diagnosis.

Materials and Methods

After a gynaecologic request, a 22 years old pregnant woman (V.S. at 11 week), has been investigated for the prenatal screening of the first trimester (Down and Edwards syndromes, through bitest).

Clinical examination and personal as well as family Y anamnesis highlighted some specific signs, suggesting clinical diagnosis of MFD (Figure 1).

Mister V.F. (Figure1, I1), Mister V.D. (Figure 1, II2) and Mrs V.S. (Figure 1, II3) showed the following dysmorphic signs: zygomatic bones hypoplasia, mandibular hypoplasia, inferior eyelids coloboma and partial cilia absence, downslanting palpebral fissures, microtia and partial Artesia of external ear duct (Figure 2). They did not show mental retardation or any intellectual disability.

genetic-syndromes-gene-therapy-novel-mutation

Figure 1: Pedigee of the family with novel mutation of the TCOF1 gene.

V.S. was hospitalised at the age of 9 for urgent surgery for a left ear abscess coming from apreauricular fistula; at the age of 20 he had been affected by a miscarriage. Others family members examined in the same setting did not show signs of MFD (Figure 1, II1 and II4).The clinical signs highlighted that the members under investigation showed the clinical features associated to Treacher Collins syndrome.

After informed consent has been obtained from patients, blood samples were collected. Genomic DNA was prepared from peripheral blood samples using purification kit (Qiagen, GmbH, Germany). Coding regions and intron/exon boundaries of the TCOF1 gene were amplified in 28 reactions using specific primers [5]. For exons 6A, 10, 16A, 24, and 25 specific primers were self-designed (Table 1).

PCR amplification was performed in a 25 μl reaction volume containing 2.5 U AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA), 1X reaction buffer (10 mM TrisHCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2), 200 μM of each deoxyribonucleoside triphosphate (dNTPs) and 0.2 mM each of primers using a PTC 100 thermocycler (MJ Research, Inc. Waltham, MA, USA).

A 10 minute denaturation step at 94°C was followed by 30 cycles at 94°C for 30 seconds, annealing temperature was performed for each primer for 30 seconds at 52.5-62°C, and extending for 30 sec at 72°C; the reaction was completed by a final extension for 7 minutes at 72°C. Amplicons were checked by agarose gel electrophoresis before sequencing analysis, to make sure that only the specific product was amplified.

PCR products were purified either by digestion with Antartic Phosphotase and Exonuclease I (New England BioLabs Inc.) and were sequenced in both directions using the Applied Biosystem Big Dye Terminator v3.1 Cycle sequencing kit. The new mutation was confirmed on more than 100 controls chromosomes by sequencing.

genetic-syndromes-gene-therapy-fissure-mandibular

Figure 2: These pictures are showing the antimongoloid slants of the palpebral fissure, mandibular and zygomatic hypoplasia, coloboma of the lower lid, and absence of lower eyelid cilia.

  FORWARD REVERSE
Ex 6A TTTATCAACTGCTGAAGCCCC ATAGTCCTCCCTCTCCCCAAC
Ex 10 CTGAACCTAGAGCCCTGTGGG AGACAGAGTCCCAGAGTGAGG
Ex 16A TGGAAACCAGAGTGCCTGAG TGATCCTGCAGCATCTGCAG
Ex 24 GCACCTCCCAACATTGAC GAACCAGGTCTGGGTGT
Ex 25 TCACTAGTCCTCAGGAGGT CTGCCTGGCTCTCTGGGA

Table 1: Primers self-designed for TCOF1 gene amplification and sequencing.

genetic-syndromes-gene-therapy-codons-later

Figure 3: One bp deletion c.599delG. It was located in exon 6 and it caused a stop codon 19 codons later.

The mutation was named according to the genomic reference (NT_029289) and the cDNA that corresponds to the major treacle isoform (NM_001135243.1) [6]. Mutation nomenclature is based on Human Genome Variation Society (H.G.V.S.) nomenclature guidelines (http://www.hgvs.org/mutnomen) [7].

Results

Molecular analysis of TCOF1 gene confirmed clinical diagnosis of V.F., V.D. and V.S., highlighting the mutation c.599delG (Figure 3).

It was located in exon 6 and it produces a stop codon 19 codons later. Such mutation has not been previously described, and results in TCS clinical phenotype.

Mrs V.S. asked for genetic counselling: she was informed about the 50% risk of conceiving a child carrying her TCOF1 mutation and about the changeable clinical expression of the disease. After reflection, she refused to undergo genetic prenatal diagnosis. At twenty weeks ultrasound screening did not evidence any sign of TCS. A healthy male was born after uneventful physiological pregnancy.

Discussion

Mandibular facial Dysostosis (MDF) are to be considered as variable clinical phenotypes. In several cases molecular genetics analysis can be helpful to define the correct diagnosis. In the investigated family, clinical suspicion was confirmed by TCOF1 analysis.

Accurate etiological definition and molecular mechanisms insights allow defining prenatal diagnosis strategies or, in postnatal diagnosis. Early diagnosis in TCS patients allows planning early and accurate interventions from clinical as well as psychological point of view. A multidisciplinary approach, including maxillofacial surgery and orthodontist, allows treating anesthetic and functional disabilities and improving quality of life.

Acknowledgements

We are grateful to colleagues working at the University of Tor Vergata (Rome, Italy) for their contribution to the recognition of mutation in the gene TCFO1.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 11558
  • [From(publication date):
    July-2012 - Sep 26, 2017]
  • Breakdown by view type
  • HTML page views : 7796
  • PDF downloads :3762
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]micsonline.com

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords