alexa The Influence of Polymorphisms in the MxA Promoter and the elF-2and#945; Regulatory Region 2 on the Natural outcome of HBV Infection | Open Access Journals
ISSN: 2161-1041
Hereditary Genetics: Current Research
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

The Influence of Polymorphisms in the MxA Promoter and the elF-2α Regulatory Region 2 on the Natural outcome of HBV Infection

Xin-su Wei1 , Ping-an Zhang1 *, Fang-li Ye1 , Yan Li1 , Bing Deng2

1Department of Laboratory Science, Renmin Hospital of Wuhan University, Wuhan, China

2Department of infection disease, Renmin Hospital of Wuhan University, Wuhan, China

*Corresponding Author:
Ping-an Zhang
Department of Laboratory Science
Renmin Hospital of Wuhan University
Wuhan, China
E-mail:[email protected]

Received date: February 24, 2012; Accepted date: April 24, 2012; Published date:April 29, 2012

Citation: Wei X S, Zhang PA, Ye FL, Li Y, Deng B (2012) The Influence of Polymorphisms in the MxA Promoter and the elF-2a Regulatory Region 2 on the Natural outcome of HBV Infection. Hereditary Genet 1:106. doi: 10.4172/2161-1041.1000106

Copyright: © 2012 Wei X S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Hereditary Genetics: Current Research

Abstract

Interferon(IFN) stimulates the expression of a number of genes encoding enzymes with antiviral activities, including myxovirus resistance A(MxA) and double-stranded RNA-dependent protein kinase(PKR). PKR is also activated by dsRNA, this leads to the phosphorylation of eukaryotic initiation factor 2a(elF-2α), which halts viral replication. We investigated whether polymorphisms in MxA promoter and elF-2α regulatory region 2(elF-2α reg2) influenced the natural outcome of hepatitis B virus(HBV) infection. A total of 243 patients with chronic HBV infection and 160 patients with self-limited HBV infection were used to genotype and identify this single-nucleotide polymorphism(SNP) by polymerase chain reaction-restriction fragment length polymorphism and sequencing, respectively. The distribution of the genotypes(GG, GT, and TT) at position -88 in the MxA promoter was 52.7%, 44.4%, and 2.9% in patients with chronic HBV infection and 41.3%, 43.1%, and 15.6% in patients with self-limited HBV infection, respectively. The frequencies of the TT genotype at position -88 in the MxA promoter were significantly higher among patients with self-limited HBV infection compared with patients with chronic HBV infection (odds ratio=6.24; 95% CI: 2.63-14.81; P=0.001). However, the polymorphisms both at position -123 in the MxA promoter and in the elF-2α reg2 were not significantly different between the two groups (P>0.05). In conclusion, Polymorphism at position -88G/T in the MxA promoter influences the natural outcomes of HBV infection to some extent. This SNP of MxA promoter may be used as a clinical prognostic marker of HBV infection.

Keywords

MxA promoter and the elF-2α regulatory region 2

Introduction

Hepatitis B virus (HBV) infection is one of the most important chronic viral diseases in the world. An estimated 400 million people worldwide are carriers of HBV, and approximately 250,000 deaths occur each year as a consequence of fulminant hepatic failure, cirrhosis, and hepatocellular carcinoma [1,2]. When HBV is acquired in adulthood, the majority of infections are cleared, with chronic infection occurring in 5% to 10% of cases [3]. However, the dynamic interaction of the host inflammatory response with HBV, and the subsequent impact of this interaction on the clinical outcome of HBV infection, are not yet fully understood, nor are the underlying mechanisms for persistence of the virus [4,5]. But it has been thought that genetic associations may also provide clues to the development of HBV infection [6,7]. Some polymorphisms have been reported to be involved in susceptibility to chronic hepatitis B, in disease severity and progression, or in disease prognosis [8-11].

Interferon (IFN) is an important cytokine for resistance to HBV infection as well as for the clinical treatment of Hepatitis B [12,13]. The antiviral mechanisms of IFN are predominately mediated through the induction of antiviral proteins [14-16]. Therefore, this study investigated the IFN-induced antiviral protein myxovirus resistance protein A (MxA) and the eukaryotic initiation factor 2α regulatory region 2 (elF-2α reg2). MxA is considered to be the strongest IFN-specific index that can directly suppress HBV replication, the SNP at the -88 and -123 positions of the MxA promoter can affect MxA mRNA expression. Protein kinase-activated elF-2α reg2 is also an important factor in IFN signal transduction, but elF-2α reg2 gene single nucleotide polymorphisms (SNPs) correlated with IFN treatment efficacy. To explore the relationship between genotype and HBV infection outcome, polymerase chain reaction-restriction fragment length polymorphism analysis was utilized to detect SNPs in the MxA promoter at positions -88 and -123 and in elF-2α reg2 in samples from patients in Hubei area of China with self-limited HBV infection and chronic HBV infection.

Materials and Methods

Subjects

According to epidemiological expert advice, a total of 243 patients with chronic HBV infection (the chronic infection group) and 160 cases of self-limited HBV infection (the self-limited infection group) from Renmin Hospital of Wuhan University in Hubei, China were studied (Table 1). All patients were diagnosed according to the diagnostic criteria for viral hepatitis issued by the 2000 Chinese Medical Association Infectious and Parasitic Diseases Committee that was jointly revised by the Hepatology Committee [17,18]; additionally, patients were screened for other hepatitis virus infections. Patients in the selflimited infection group were not vaccinated against HBV, and the lab results for hepatitis B surface antigen (HBsAg) negative, anti-HBs antibody (anti-HBs) positive, blood count and biochemical parameters were within the reference range, which excluded the presence of liver, kidney, endocrine, or cardiovascular disease. As also shown in Table 1, differences in gender and age between chronic infection group and selflimited infection group were of no significance. Informed consent was obtained from each patient before inclusion into the study. Likewise, the study conformed to the ethical guidelines of the Helsinki declaration was approved by the Renmin Hospital of Wuhan University ethics committees.

Category Cases(n) Gender
(male/female)
Age(mean±SD)
Self-limited infection group 160 106/54 56.4±14.0
Chronic infection group 243 178/65 54.7±14.8
P Value   0.807 0.569

Table 1: Characteristics of patients with chronic HBV infection.

Specimens preparation

Blood samples were collected from the patients in the two groups. Using Genomic DNA Extraction Kits ( SBS Biological Engineering Co., Ltd, Shanghai, China), we extracted whole blood genomic DNA, which was stored at -20°C until use.

Primer design and main reagents

Gene sequences and the corresponding SNP sites for the MxA promoter and the elF-2α reg2 gene were obtained from the U.S. National Center for Biotechnology Information’s Gene Bank (GenBank). Primer5.0 and a reference paper [19] were used to design the necessary primers. The primers were synthesized by SBS Biological Engineering Co., Ltd. The primer sequences for the MxA promoter -88 and -123 positions amplified a 350 bp fragment of DNA. The sequences of the primers utilized to amplify a 563 bp fragment of the elF-2α reg2 gene were as shown in Table 2. Taq DNA polymerase, dNTPs, and DNA molecular weight markers were purchased from Takara Biotechnology Co., Ltd (Dalian, China). HhaI, PstI, and SspI restriction enzymes were purchased from Shanghai Biological Engineering Technology Services Co. Ltd., (Shanghai, China) which distributes Amersham Life Sciences (Cleveland, OH, USA) products.

Digestion sites PCR Primer sequences
(direction 5’to3’)
Restriction enzymes Digestion products(bp) Genotypes
MxA promoter
-88 G/T
F:TGAAGACCCCCAATTACCAA
R: CTCTCGTTCGCCTCTTTCAC
Hha I 259 GG
310 TT
310, 259 GT
MxA promoter
-123 C/A
F:TGAAGACCCCCAATTACCAA
R: CTCTCGTTCGCCTCTTTCAC
Pst I 225, 125 CC
350 AA
350, 225, 125 CA
elF-2α reg2
A/G
F:TGCTTGCTAGTTTGTTTCCCAC
R:GCCATGTACATCACAGGTTTACTG
Ssp I 476 AA
563 GG
563, 476 AG

Table 2: DNA products size and genotypes of the three digestion sites in the MxA promoter and elF-2α.

Self-limited patients
n, )
Chronic HBV patients
n, )
OR 95 CI P
MxA-88 alleles
G 201(62.8) 364(74.9) 0.57 0.42~0.77 0.001
T 119(37.2) 122(25.1)
MxA-88 genotypes
GG 66(41.3) 128(52.7) 0.63 0.42~0.94 0.025
GT 69(43.1) 108(44.4) 0.95 0.63~1.42 0.765
TT 25(15.6) 7(2.9) 6.24 2.63~14.81 0.001
MxA-123 alleles
C 262(81.9) 387(79.6) 1.15 0.81~1.66 0.380
A 58(18.1) 99(20.4)
MxA-123 genotypes
CC 110(68.7) 156(64.2) 1.23 0.80~1.88 0.346
CA 42(26.3) 75(30.9) 0.80 0.51~1.24 0.324
AA 8(5.0) 12(4.9) 1.01 0.40~2.54 0.990
elF-2α reg2 alleles
A 286(89.4) 417(85.8) 1.39 0.90~2.16 0.178
G 34(10.6) 69(14.2)
elF-2α reg2 genotypes
AA 130(81.3) 186(76.5) 1.33 0.81~2.18 0.259
AG 26(16.2) 45(18.5) 0.85 0.50~1.45 0.653
GG 4(2.5) 12(5.0) 0.49 0.16~1.56 0.241

Table 3: Comparisons of three polymorphisms between patients in self-limited and chronic HBV infection.

SNP analysis

The PCR amplifications were performed in a final volume of 25- μL using the following reagents: 2.5μL of 10×PCR reaction buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 9.0, 1 g/L Triton X-100), 1.0 U of Taq DNA polymerase, 200μmol/L of each dNTP, 2.0 mmol/L of MgCl2, 0.4μmol/L of each primer, and 50-100 ng of template. For the amplification of the MxA promoter -88 and -123 positions, the conditions were as follows: denaturation at 94°C for 5 min followed by 35 cycles of denaturation at 94°C for 45 s, annealing at 57°C for 45 s, and extension at 72°C for 1 min with a final extension at 72°C for 5 min. The amplification conditions for the elF-2α reg2 locus were as follows: denaturation at 94°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 1 min with a final extension at 72°C for 7 min. PCR amplification products were assessed using agarose gel electrophoresis, ethidium bromide (EB) staining, and observation under ultraviolet light. Mixtures of 8-μL of the reaction products and 2-μL of loading buffer (300 mL/L glycerol, 0.75 g/L bromophenol blue) were run on gels with DNA molecular weight standards to enable product identification. For digestions, PCR products (10-μL), 10× buffer (2-μL), restriction enzyme (1-μL of a 2 U/ μL mix), and 10 × BSA (2-μL) were mixed with deionized water for a total volume of 20-μL per reaction. Digestions were performed at 37°C for 4 h. Digestion products (12-μL) were run in 20 g/L agarose gels and visualized under UV light with reference to DNA standards to identify fragments. The three digestion sites are listed in Table 2. Additionally, selected PCR products were analyzed by DNA sequencing to confirm the PCR-RFLP results.

Statistical methods

Alleles and genotype frequencies in MxA promoter -88 G/T and -123 C/A sites and the elF-2a-reg2 were calculated manually in 160 patients with self-limited HBV infection and 243 patients with chronic HBV infection. The differences in distribution of the genotypes and alleles between groups and the Hardy-Weinberg equilibrium were tested using chi-square tests and Fisher’s exact tests. The genotype distribution comparisons between two groups were done after adjusting genotype distribution for potential confounding factor such as age and gender using analysis of covariance (ANCOVA). The odds ratio (OR) with 95% CI was also calculated. For statistical analysis, we used SPSS 11.0 software to perform. A P value of < 0.05 was considered statistically significant.

Results

Analysis of MxA promoter gene polymorphism

Consistent with expectations, the MxA promoter PCR products were 350 bp in size. Products of individual digestions with HhaI (digestion of the MxA promoter -88 G/T position) and PstI (digestion of the MxA promoter -123 C/A position) are in Figures 1 and 2. DNA sequencing has the same results with the RFLP. All polymorphism results of patients with MxA promoter -88 G/T and -123 C/A genotypes are presented in Table 2. Overall, the GG, GT, and TT genotypes at the -88 position of the MxA promoter were detected in 48.1% (194/403), 43.9% (177/403), and 8.0% (32/403) of the samples, respectively. At the -123 position of the MxA promoter, the CC, CA, and AA genotypes were detected in 66.0% (266/403), 29.0 % (117/403) and 5.0% (20/403) of samples, respectively. The genotype distributions of MxA promoter -88 G/T and -123 C/A in both present populations followed the Hardy-Weinberg equilibrium. Compared to patients with chronic HBV infection, the -88 position of the MxA promoter in patients with self-limited HBV infection carried the GG genotype (P=0.025) or G allele (P=0.001) with a lower frequency and the TT genotype (P=0.001) or T allele (P=0.001) with a higher frequency (OR=6.24, 95% CI: 2.63- 14.81). The influences of gender and age were also of no significance when analysis of covariance (ANCOVA) was used after adjusting genotype distribution according to age and gender(Table 4). The frequencies of MxA promoter position -123 genotypes and alleles were not significantly different between the two groups. Furthermore, we performed the haplotype analysis for evaluating the haplotype frequencies of SNPs located at MxA promoter -88 G/T and -123 C/A, trying to derive haplotypes specifically correlated with the natural outcome of HBV infection. The results are summarized in Table 5. The haplotypes of the MxA promoter -88 G/T and -123 C/A show a significant different distribution between the patients with chronic HBV infection and the patients with self-limited HBV infection.

hereditary-genetics-MxA-promoter

Figure 1: Results of the MxA promoter -88 G/T position gene typing. Lane M: DNA molecular weight maker; Lane 1: TT genotype; Lane 2: GT genotype; Lane 3: GG genotype

Genotype Self-limited patients Chronic HBV patients
Gender
(male/female)
Age
(mean±SD)
Gender
(male/female)
Age
(mean±SD)
GG 42/24 57.6±13.4 98/30 55.9±13.1
GT 46/23 55.2±14.7 75/33 53.3±16.6
TT 18/7 56.5±13.9 5/2 53.9±13.8

Table 4: Gender and age in different genotype of MxA promoter -88 G/T between patients in self-limited and chronic HBV infection.

Genes Haplotypes Self-limited patients
n=320, %)
Chronic HBV patients
n=486, %)
P
MxA promoter -88, 123 GC 191(59.7) 346(71.2) 0.012
TC 39(12.2) 41(8.4)
GA 10(3.1) 18(3.7)
TA 80(25.0) 81(16.7)

Table 5: Haplotype analysis of SNPs located at MxA promoter -88 G/T and -123 C/A.

hereditary-genetics-fatty-infiltration

Figure 2: Results of the MxA promoter -123 C/A position gene typing. Lane M: DNA molecular weight maker; Lane 1: AA genotype; Lane 2: CC genotype; Lane 3: CA genotype.

Analysis of elF-2α reg2 gene polymorphism

The elF-2α reg2 gene PCR products were 563 bp in size, consistent with the expected amplified DNA fragment size of the primers designed in this study. PCR products were digested with SspI; the electrophoresis results are shown in Figure 3. The DNA sequencing and the RFLP detected the same elF-2α reg2 genotypes. The elF-2α reg2 AA, AG, and GG genotypes were detected in 78.4% (316/403), 17.6% (71/403), and 4.0% (16/403) of patients, respectively. The genotype distributions of elF-2α reg2 in both present populations followed the Hardy-Weinberg equilibrium. Genotypes and alleles frequencies were not statistically significant between the two groups (Table 3).

hereditary-genetics-gene-typing

Figure 3: Results of the elF-2α reg2 position gene typing. Lane M: DNA molecular weight maker; Lane 1: AG genotype; Lane 2: GG genotype; Lane 3: AA genotype.

Discussion

Epidemiological data indicate that host genetic factors significantly affect the development and persistence of chronic HBV infection [20,21]. Further evidence indicates that host genetic factors can control the production of certain cytokines or sensitivities to cytokines to regulate the host immune response, thereby inhibiting HBV replication [22,23]. Following infection, the most important early antiviral response is induction of IFN production [24]. Normal cells generally do not spontaneously produce IFN, they have the potential for IFN synthesis [9]. Under homeostatic conditions, IFN genes are suppressed in the quiescent state; however, this suppression is lifted after viral infection, enabling IFN expression [25]. When bound to its receptor, IFN activates downstream JAK-STAT signaling pathways for the formation of two transcription factors, IFN-alpha-activated factor(AAF)and IFNstimulated gene factor 3 (ISGF3). AAF and ISGF3 translocate into the nucleus and bind to antiviral protein gene promoters containing IFN response-stimulated elements (ISREs), which leads to IFN-induced antiviral gene expression and the generation of a variety of antiviral proteins, including protein kinases, 2 ', 5'-oligoadenylate synthetase, and MxA [26-28].

MxA is considered to be the strongest IFN-specific index that can directly suppress HBV replication [29]. According to GenBank, the MxA promoter has three similar ISRE sequences; the -88 position of the MxA promoter, the second ISRE sequences are similar. The similarity of the -88 region to ISRE sequences increases after the occurrence of G®T mutations. The G to T mutation can promote MxA mRNA expression, generating increased MxA protein levels that exert antiviral effects. It is hypothesized that the SNP at the -88 and -123 positions of the MxA promoter can affect MxA mRNA expression [30]. This study found that the TT genotype and T allele at MxA promoter position -88 were more common in patients with self-limited HBV infection compared to patients with chronic HBV infection (OR=6.24; 95% CI: 2.63-14.81). It is possible that individuals with the T allele (GT, TT) express more MxA protein compared to individuals with a non-T genotype (GG); increased MxA expression could help resolve natural HBV infections. Therefore, the GT and TT genotype at MxA promoter position -88 may exert a more potent anti-HBV effect compared to the GG genotype. The relationship between MxA promoter polymorphism at position -123 and viral infection outcomes has been less well studied. In a study concerning chronic hepatitis C infection suggested that MxA promoter C/A SNP at position -123 affected interferon therapy; further, these authors indicated that the -123 position SNP was highly connected with the -88 position G/T SNP [31,32]. However, in our study, it was found that the frequencies of MxA promoter -123 locus genotypes and alleles were not statistically different between patients with chronic HBV infection and patients with self-limited HBV infection. This result may be related to the sample size or virus genotype.

Protein kinase-activated elF-2α reg2 is also an important factor in IFN signal transduction. King et al. studied 82 patients to evaluate the relationship between elF-2α reg2 gene SNPs and response to IFN treatment in chronic hepatitis B patients in Taiwan; the results suggested that elF-2α reg2 gene SNPs correlated with IFN treatment efficacy. IFN treatment efficacy in AG genotype patients with chronic hepatitis B was not satisfactory. In this study, we looked from another point of view and observed the relationship of elF-2α reg2 gene SNPs and the natural outcome of HBV infection and found that the frequencies of different elF-2α reg2 genotypes and alleles in patients with self-limited HBV infection and patients with chronic HBV infection were not statistically significant. These results suggest that the elF-2α reg2 gene in HBV infection may not play a major role in viral clearance.z

There are many factors that affect the outcome of HBV infection. In addition to the molecular characteristics of the virus and the biology of the host immune response against HBV and other factors, the antiviral activity of IFN depends on many genes in the signaling pathway and the various antiviral proteins produced [33,34]. Therefore, the relationship between MxA promoter and elF-2α reg2 gene polymorphisms and the natural outcome of HBV infection only shows one aspect of the diverse nature of the host genetic background and its complexity in relationship to viral infection. The evaluation of the relationship between the IFN signaling pathway gene SNP and HBV infection requires the large-scale detection of SNPs. The accumulation of more data that take various factors into consideration is needed to reach a definitive conclusion. In short, because host genetic factors produce changes in the natural outcome of HBV infection, it is worth intensive future study. Compared to elF-2α reg2 gene SNPs, the G/T polymorphism in the MxA promoter at position -88 is expected to become a predictor of HBV infection outcome and drug treatment responsiveness.

Acknowledgements

The authors thank all the chronic HBV patients and the self-limited patients who agreed to participate in the study.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 11561
  • [From(publication date):
    June-2012 - Oct 23, 2017]
  • Breakdown by view type
  • HTML page views : 7801
  • PDF downloads :3760
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords