Breeds Sequences Transcription Factors binding Luciferase analysis     GATA-1 GATA-2 Th1 E4 CP2 c-Ets   D´man (Ref) GTTTGGTTCTGGCATCCTAG no no Yes Yes no no Standard   GTTTGGTTCCGGCATCCTAG no Yes no no Yes no moderate increase with 4%   GTTTGGTTCTGGCATCCTGG no no Yes Yes Yes Yes decrease with 53%   GTTTGGTTCCGGCATCCTGG Yes Yes No No Yes Yes decrease with 61%

Table 5: Transcription factors binding in the core region that are affected by mutation. The marked monomers show the mutation. Here we depict only those TFs that are affected by the mutation.

Goto home»