Primers Primer sequences (5’.....3’) Annealing temp. °C Host of Bacteroides Amplicon size (bp) References Bac32F AACGCTAGCTACAGGCTT 53.7 General 670 [5] HF183F ATCATGAGTTCACATGTCCG 55.3 Human 520 [5] CF128F CCAACYTTCCCGWTACTC* 54.8 Cow 580 [5] HoF795F GCGGATTAATACCGTATGA 56.7 Horse 129 [23] PF163F CCAGCCGTAAAATAGTCGG 52.4 Pig 563 [23] Bac708R CAATCGGAGTTCTTCGTG - - - [5] *W: A or T, Y:C or T, Bac708R: reverse primer

Table 1: The previously designed host-specific Bacteroides primers used in this study, all forward primers were coupled with reverse primer Bac708R.

Goto home»