Gene Function Swissprot-ID F/R Primer Sequence
CYP18 A1-like Ecdysteroid involved in moult and metamorphosis [12] sp|Q95078|CP18A_DROME F TGGGAGGTGAAACCGTCGTAGT
R CCCCCAGAAGCTGGGATAACTCTGT
Trypsin-1 Serine protease involved in feeding, digests mucus and skin [13] sp|P00765|TRYP_ASTFL F TGGTCGCAACTGCTCTTGCA
R GGCTCTGCCTCTTCACCACCG
Tissue plasminogen activator precursor-like Degrades blood plasma proteins preventing clotting [14] sp|P11214|TPA_MOUSE F AGGGAAATGCCATGGTGTGCAACT
R TGACACCATCATTACACGACCTCGT
Cytochrome p450 isoform 1-like Protein Drug metabolism of aromatic hydrocarbons [15] sp|Q9VEG6|PERC_DROME F TGGGCTTTGGCCGCTCCAAA
R GGCTGTGTCCGAATCGAAAGGCA
Peroxinectin-like Louse immune system, encapsulation of invaders [16] sp|Q96B70|LENG9_HUMAN F AGGTATACGGGAAGGCACAGACCT
R TGGCCAAAGGTACCCAGTCCT
Leukocyte receptor cluster member 9-like Immune response [17,18] sp|Q9VG82|CP9F2_DROME F TTGGGGTGGAAGCAGGCTGC
R ACGCAAAAACCAATGCTTGTCTCCA
Glycene receptor α-2 Like Mediates inhibitory neurotransmission [19] sp|P19019|GBRB3_CHICK F ACGACGCTTCACGTGTGGAGT
R AGAGGCCCGGAAAGTTGTTGAGT
Nicotinic acetylcholine receptor subunit-like Excitatory neurotransmitter receptor [20] Q9VG82 F CTCTGCCGCACATCCACCCC
R TGGTGGAGGCGGAGGCTGAT
Table 1: Brief description of Lepeophtheirus salmonis putative gene function and primer sets. Putative functions were assigned by BLASTx searching full L. salmonis sequences in both the Swiss-Prot and nr databases and using a consensus to determine function.
Goto home»