Primer name Primer Sequence
Cr-Pgp_F ACACCTTTCCTGGATGGAGTCACTC
Cr-Pgp_R CTTGCGTTCCATTTGTCCAT
Cr-Pgp_Race5_R1 AATGAGACCAATGATGGCCG
Cr-Pgp_Race5_R2 AAAGCGAGTGACTCCATCCA
Cr-Pgp_Race3_F1 TTGAATCAAGGACGAGTGGC
Cr-Pgp_Race3_F2 AAGTCACGACTCACTCCTCT
Cr_P-gp_qF AATCTTCCGAGGTGTCCTCA
Cr_P-gp_qR ACAGAGTTCTCGGTCGTCTA
Cr_P450_qF CACCAGGATTTTCAGCTCCA
Cr_P450_qR TACTTCCCGGAACCCAATGA
Cr_1266_F TGATGGTGGATGATGTGGAC
Cr_1266_R AAAACTGGCTCTTGGCCTAC
Cr_1353_F TCGGGATAATATCTGCGTCG
Cr_1353_R AAAATCGTACGCATTCGCAG
Table 1: Sequences of primers used in this study.
Goto home»