Primers name Sequences (5’ to 3’) Accession No.
zIGF(f) CGACAGGATATGGACCTAGTTCAA NM_131825
zIGF(r) ACAATACATCTCGAGGCGCC NM_131825
zPGRN(f) AGTAGCACAGGGCCTTGCAT AF375477
zPGRN(r) CTTTTACTTTCCGTTTGACACACAA AF375477
ef-1a (f) TGCCTTCGTCCCAATTTCAG L47669
ef-1a (r) TACCCTCCTTGCGCTCAATC L47669
pPGRN5-NotI (f) CGGCCGCTTCTTACCT TCATCTCTGAAATCTTGCCAT ---
pPGRN5-MluI (r) ACGCGTGTTGCTGTAGCTGTCAATCATTAACAGATG ---
pPGRN4-NotI (f) CGGCCGCATGTTCTGG GCCACTGAACACAGGTT ---
pPGRN4-MluI (r) ACGCGTGTTGCTGTAGCTGTCAATCATTAACAGATG ---
pPGRN3-NotI (f) CGGCCGCATGCATATCAAATTTTGGTCTTCAATGGA ---
pPGRN3-MluI (r) ACGCGTGTTGCTGTAGCTGTCAATCATTAACAGATG ---
pPGRN2.4-NotI (f) CGGCCGCAACTACCTAAAACTTGCATTTGGATTCGTA ---
pPGRN2.4-MluI (r) ACGCGTGTTGCTGTAGCTGTCAATCATTAACAGATG ---
pPGRN1.5-NotI (f) CGGCCGCTTGTTTTCATTCTCATTTGACTCTTTCTGC ---
pPGRN1.5-MluI (r) ACGCGTGTTGCTGTAGCTGTCAATCATTAACAGATG ---
pPGRN1-NotI (f) CGGCCGCCTGAACAGATAATCAAAGTCTAAAAAGTTA ---
pPGRN1-MluI (r) ACGCGTGTTGCTGTAG CTGTCAATCA TTAACAGATG ---
zHNF1a (f) ATGGACGGAGGAGAGTCGAGGAGATCAGAA AF244934
zHNF1a (r) CTATTGTGCAGTGGAGACCATCTGTGCAGGAAT AF244934
HNF3b (f) ATGCTCGGTGCTGTCAAAATGGAGGG NM130949
HNF3b (r) TTAGGAAGAGTTCAGGATGGGCCTGG NM130949
C/EBPb (f) ATGGAAGTGGCCGGTTTTTACG NM131884
C/EBPb (r) TCAGCACTGGCCGGTGGCGGAG NM131884
Table 1: Oligonucleotide primers used for PCR amplification of the PGRN promoter and specific genes.
Goto home»