Primer name Primer sequence (5’-3’) Position within gene Repeat motif References (GeneBank Accession no.)
PRL I-MS01 F:GTTAGCCCCCTCCTCACTCT promoter of prolactin GT X92380
R:ACCTTGCTCGTCACACCTG
PRL I-MS02 F:TCGTGTCTTGTGGGGAAACC promoter of prolactin CA X92380
R:TGAATGGATGCAACAGGATG
IGF-II-MS01 F:TCCCCAGCTGGAAGATGTGTCACG promoter of IGF-II CT AF033802
R:CTGGACGCAGCTGAAATCCTGTGG
IGF-II-MS03 F:ATGCTAGCAAACATCAAAGGTC 3’UTR of IGF-II ATCT AF033804
R:GATATGCTGATGATGCACAGAGTC
GH-MS01 F:CCAGCCATGAACTCAGGTAAGACA intron 1 of GH TGTC M97765
R:TGCTGAGAGGAGACGCCCAAACA
ISP-MS01 F:GAGCTGAGCAGATGGAGCAGAAG 5’UTR of insulin precursor CA AF038123
F:GAGCTGAGCAGATGGAGCAGAAG
Table 1: Primer sequences used in this study and repeat motifs of six microsatellites located within growth-related genes.
Goto home»