No. Primer name Clone Sequence
Forward (5' -----------------> 3') Reverse (5' --------------------> 3')
1 DTLSH 7 SH2-9F AACGAAACCAAAAATATCTTACC AGGCAGTGATGTATCAGCTG
2 DTLSH 8 SH2-10C GTACGAGGATCTAAAGGTGG TACTAAAGCGTGTCTGTGGC
3 DTLSH 9 SH2-11D AATTGTTGCCTTCGTCAGGG AACAAAGCCGAGCAAAACCG
4 DTLSH 12 SH3-11G TCGCTGGAAAACACGAATGG AAAGCTTAGGGGTTGAGTGG
Table 1: The base sequences of primers.
Goto home»