Primer name Sequences (5’-3’) Description
PajCHS PCF1 AACAATCTTGGAGCTGCTTGTGGAC Forward primer for EST sequence confirmation
PajCHS PCF2 GGACTTATGGTATGGTATCAGATG Forward primer for EST sequence confirmation
PajCHS PCR1 CCTAGACTGACGTCTTTCTTGGAC Reverseprimer for EST sequence confirmation
PajCHS PCR2 CGTCTTTCTTGGACCACAGTCTCG Reverseprimer for EST sequence confirmation
PajCHS5R R1 TGAACAGTCCTCTTGTAGTCTTGC Specific reverse primers for 5’ region
PajCHS5R R2 GTACATAATGACGAGCTTGGCTA Specific reverse primers for 5’ region
PajCHS5R R3 TAAGGAGTTGTACATTGGAGAGACAAA Specific reverse primers for 5’ region
PajCHS5R R4 TGCGATCCATGTTTGGGAAAGTAACCAAAA Specific reverse primers for 5’ region
PajCHS DEGF1 GARACNAARGGNTGG Degenerate forward primers for 5’ region
PajCHS DEGF1-1 GGNTGGGAYGTNTTY Degenerate forward primers for 5’ region
PajCHS DEGF2 TTYWSNTAYGCNTTYCCN Degenerate forward primers for 5’ region
PajCHS DEGF3 CARGGNTTYWSNTAYGCN Degenerate forward primers for 5’ region
PajCHS3R F2 CATTTATCCAGAGGAATGCTGTTG Specific reverse primers for 3RACE
PajCHS3R F3 CAAGCAATCGGAACGTTGGACGTGGC Specific reverse primers for 3RACE
PajCHS DW5R R5 CCCGAAACTAGCACAACACCGAAGGT 5’RACE reverse specific primer
PajCHS DW5R R6 CATCGAGGAACTTTTGGTTGTCCTC 5’RACE reverse specific primer
PajCHS DW5R R7 GTTGTCCTCCGAGAGAGAACCCGTGGAC 5’RACE reverse specific primer
PajCHS RTFD TGTACACTGTTGCTTCAGCGAGGT PajCHS Forward primer for qPCR
PajCHS RTRD AGCTACAAAGGCACCCACCAACAT PjCHS Forward primer for qPCR
PajCHSfull con F1 GAAGTTACTGAGGAATTCTTAAAGGATC Forward primer for ORF confirmation
PajCHSfull con F2 AGGATCATTGTGCTCGGATGC Forward primer for ORF confirmation
PajCHSfull con R1 ATTGTACATATAAATAATGAAAAGCCTG Reverse primer for ORF confirmation
PajCHSfull con R2 ATAATGAAAAGCCTGTCTAGGAGAG Reverse primer for ORF confirmation
M13F (-40) CAGGAAACAGCTATGAC Vector FWD primer for DNA sequencing
M13R (-20) GTAAAACGACGGCCAG VectorRVS primer for DNA sequencing
Table 1: List of primers used for the cloning of PajCHS and qPCR.
Goto home»