Gene name Primer sequences Product size (bp) Genebank number
IL-10 F:GCACCATTACTCGATGAAAACG
R:CTGGCGAACTCAAAGGGATT
236 JF957369
TNF-α F: GCCATAGGAATCAGAGTAGCG
R: GACCAGGCTTTCACTTCAGG
183 JF957372
HSP70 F: CACAATCACCAACGATAAGGG
R: TTGGCAGACACCTTTTCACGC
114 JF957366
TGF-β 40S F: CCTGGGCTGGAAGTGGATAC
R:GTAAAAGATGGGCAGTGGGTC
F:GTTGTACTTGCGGATGTAATGC
R:TGGCTGTTGAAGGAAGTGGC
190 233 JF957371 JF957364
Table 3: Primer sequences for QPCR.
Goto home»