Primer name Sequence Application Reference
Spiro-1f AAGATTAAGCCATGCATGCC PCR/Seq Jorgensen & Sterud [31]
Spiro-2r GCAGCCTTGTTACGACTTCTC PCR/Seq
Spiro-3r CATTGGGYAATYTYCCGCCCT Sequencing
Spiro-4f GAYTCYGGAGAVTGRGCAYGAG Sequencing
Spiro-5r STYTCCGTCAATMCYTTMAAGTTTC Sequencing
Spiro-6f AAGRYTGAAACTTKAARGKATTGACGG Sequencing
Spironucleosis-1f TCATTTATCAGTGGTTAGTACATGC PCR/Seq
Spironucleosis-2r TTCAAGCCTAACCACGACAAG PCR/Seq
Salmonis-1f TTGTGTACGAGGCAGTGACG PCR/Seq Fard et al. [66]
Salmonis-2r TCCCCGGTTCGTTGGTCAAG PCR/Seq
Torosa 16sf CTCTTGAGTGAGGTAGTCACCAGC PCR/Seq Jorgensen et al. [73]
Torosa 16sr GTGTCCGAATAACTCACCAAAACC PCR/Seq
Table 3: Primer sequences for amplification of the small subunit ribosomal RNA (SSU rRNA) gene for identification of fish diplomonads to the genus or species level using PCR or sequencing approaches. Primers Spiro-1 and Spiro-2 will amplify most member of the genus Spironucleus and Hexamita. Spiro-3 to Spiro-6 may be used as sequencing primers for most species of Spironucleus and Hexamita. The Spironucleosis, Salmonis and Torosa primers are specific for S. salmonicida, S. salmonis and S. torosa, respectively
Goto home»