Primer Sequence   (5’-3’) size (bp) Reference
B22 TGT TCT GTC CTA TCG CAA CG 115 Bretagne et al, 1993
B23 TGG GTC TAC GTC GAT GGC ATG ACA AC
529F GAGACCGCGGAGCCGAAGTGC  393 Present study
529R  CCTCCTCCTCCCTTCGTCCAAG
Table 2: Primers sequence, size of each fragment and references for each fragment.
Goto home»