ENV Region Primers I Primers II
V1-V2 ForA 5’ACCCCACTCTGTGTCACTTT3’ RevA 5’TATTACACTTTAGAATCGCA3’ ForB 5’AAGTTGACCCCACTCTGTGT3’ RevB 5’CTTTAGAATCGCATAACCAG 3’
V3-C3 ForA 5’CTGTTAAATGGTAGCCTAGC3’ RevA 5’GCAATAGAAAAATTCTCC3’ ForB 5’CACAGTACAATGTACACATG3’ RevB 5’RCAATAGAAAAATTCTCCTC3’
V4-C4-V5 ForA 5’GTRGAGGAGAATTTTTCTATTG3’ RevA 5’TATAATTCACTTCTCCARTTGTC3’ ForB 5’ TTTAATTGTRGAGGAGAATTTTTCTATTG3’ RevB 5’ TATTTATATAATTCACTTCTCCAATTGTC3’
In case amplification failed using the first couple of primers (Primers I), nested PCR was repeated using another couple of inner primers (Primers II).
Table 1: Primers used for nested PCR amplification of selected regions of gp120 HIV env.
Goto home»