Primer Sequence Melting temperature (Tm) Product size (bp)
Reference gene  
β-actin Forward TGGGTATGGAATCCTGTGG 55.78 96
Reverse GCACTGTGTTGGCATAGAGG 56.18
Target genes:  
iNOS Forward GGAGCCTTTAGACCTCAACAGA 58.03 104
Reverse GGCTGGACTTTTCACTCTGC 57.17
TNF-α Forward CCACCACGCTCTTCTGTC 57.79 114
Reverse ATCTGAGTGTGAGGGTCTGG 57.62
TGF-β1 Forward GCTAATGGTGGACCGCAAC 58.57 100
Reverse CACTGCTTCCCGAATGTCTG 58.72
Table 1: Primers used in real-time polymerase chain reaction.
Goto home»