Locus name

Repeat motif

Primer pair sequence (5’-3’)

Tm (°C)

Size range

No of alleles

HO

HE

HEW
P-value

PIC

GenBank
Accession no.

CQ1

(GT)16

F:ACCTGTCGCACTCTGTATCAA
R:ACCTAGTAGCGATCAATGAAGAG

56.4

273-293

3

0.6897

0.6439

0.6878

0.5617

HM035026

CQ2

(CA)42

F:TCACCAGGCTTTGAAATAGT
R:CATTTGCCGTCTTCCATACC

56.4

180-240

7

0.8167

0.8174

0.2154

0.7850

HM035027

CQ3

(GT)24

F:ACTTCTCTGTGTATATATCCTGTG
R:CAGACACCAAACACCAAGAT

56.4

154-193

3

0.3103

0.3405

0.1834

0.3121

HM035028

CQ4

(TG)13

F:TAGCACCAGAGAGAGTCAGG
R:TGGAGCAGGAAAAGTGAG

56.4

183-200

3

0.5000

0.5118

0.4754

0.3868

HM035029

CQ5

(AC)15

F:TAGTAGCGACCAGTGAAGAG
R:GCGTTGTTTTGACACAGAAG

56.4

187-237

4

0.5714

0.6173

0.0817

0.5322

HM035030

CQ6

(CA)23

F:CTAGTCGCTACCAGCAAAGA
R:CAACCTCCTGGGACTTACTG

50.4

408-418

2

0.6032

0.4246

1.0000

0.3325

HM035031

CQ7

(TG)22

F:TGTCTTCAACTTCCAACTGTG
R:ATAAATGTGAGAGCCCAGGT

50.4

175-246

3

0.7600

0.6305

0.9729

0.5478

HM035032

CQ8

(TG)14

F:TCCCTGTGATTCATCTGTTT
R:GTAGCGATCAGTGAAGAGGC

63.9

382-405

2

0.8000

0.4837

1.0000

0.3648

HM035033

CQ9

(TG)13

F:CTCCACTATTCTGTTTGCTTTG
R:GTAGCAATAAGCGAAGAGGC

62.7

171-175

2

0.4688

0.3780

0.9944

0.3047

HM035034

CQ10

(CA)18

F:ACACACACGCACAAGGGTAGAC
R:CCGATTTCCCTCAACCTTTC

62.7

261-289

4

0.8615

0.6730

0.9998

0.6101

HM035035

CQ11

(TG)11

F:CCATTGTACCTCCCTTTTTT
R:CAGCCACAGTAGCAGTCAGT

50.4

332-365

2

0.2549

0.3931

0.0171*

0.3135

HM035036

CQ12

(AC)40

F:GTTCAGGGAGAGTGACCTAGTAGC
R:CCTCCTCGGTTGTTATGTTATT

50.4

389-403

2

0.6000

0.4923

0.9533

0.3675

HM035037

CQ13

(GT)37

F:TGTGACCCCTTGTTTCTGTG
R:GCCCGTCATTCAAGCCAAAG

63.9

239-258

3

0.3810

0.5116

0.0978

0.4551

HM035038

CQ14

(TG)29

F:TTTCCTCAGCCTTATCACCT
R:GGTAATGAACTCTGGGTAGGTC

55.0

330-363

3

0.8537

0.5285

1.0000

0.4188

HM035039

CQ15

(TG)26

F:ATACTCCCTCTTGGTGTTCC
R:GTAGCGGTCAGTGAAGAGGC

63.9

380-403

2

0.7846

0.4805

1.0000

0.3631

HM035040

Average

 

 

 

 

3

0.6171

0.5284

0.6453

0.4437

 

HO, observed heterozygosity; HE, expected heterozygosity; HWE, Hardy–Weinberg equilibrium; PIC, polymorphic information content of each locus; and GenBank accession numbers for DNA sequences of loci; * Locus deviating from HWE.
Table 1: Microsatellite isolated from Redclaw Crayfish (Cherax quadricarinatus).
Goto home»