Gene GenBank
Acc. No.
Forward
primer
Reverse
primer
Probe Size
bp
ELF1-α AF498320 accctcctcttggtcgtttc tgatgacaccaacagcaaca gctgtgcgtgacatgaggca 63
SAA X99385 gggagatgattcagggttcca ttacgtccccagtggttagc tcgaggacacgaggactcagca 79
Hepcidin AF281354 gaggaggttggaagcattga tgacgcttgaacctgaaatg agtccagttggggaacatcaacag 95
Precerebellin AF192969 tggtgttgctttgctgttgt gccacttttggtttgctctc atggttgagactcagacggagagtg 116
IgM S63348 cttggcttgttgacgatgag ggctagtggtgttgaattgg tggagagaacgagcagttcagca 95
IgT AY870265 agcaccagggtgaaacca gcggtgggttcagagtca agcaagacgacctccaaaacagaac 73
IL-1β AJ223954 acattgccaacctcatcatcg ttgagcaggtccttgtccttg catggagaggttaaagggtggc 91
Lysozyme X59491 gaaacagcctgcccaact gtccaacaccacacgctt atacccaggccaccaaccgcaacac 188
Table 1: Primers and probes including their GenBank accession numbers, product size and sequences. The efficiencies of all qPCR assays are within 100% ± 5%.
Goto home»