alexa High Expression of NETO2 in Osteosarcoma Promotes Cell Proliferation and Migration
1165-158X

Cellular and Molecular Biology
Open Access

OMICS International organises 3000+ Global Conferenceseries Events every year across USA, Europe & Asia with support from 1000 more scientific Societies and Publishes 700+ Open Access Journals which contains over 50000 eminent personalities, reputed scientists as editorial board members.

Open Access Journals gaining more Readers and Citations
700 Journals and 15,000,000 Readers Each Journal is getting 25,000+ Readers

This Readership is 10 times more when compared to other Subscription Journals (Source: Google Analytics)
  • Research Article   
  • Cell Mol Biol 2018, Vol 64(1): 147
  • DOI: 10.4172/1165-158X.1000147

High Expression of NETO2 in Osteosarcoma Promotes Cell Proliferation and Migration

Tian-Long Wu1, Tian-Shu Wu2, Xiao-Nan Zhang1 and Zhi-Ming Song1*
1Department of Sports Medicine, The First Bethune Hospital of Jilin University, Changchun, Jilin, P.R. China
2Department of Orthopedics, China-Japan Friendship Hospital of Jilin University, Changchun, Jilin, P.R. China
*Corresponding Author: Zhi-Ming Song, Department of Sports Medicine, The First Bethune Hospital of Jilin University, No. 71 Xin Min Street, Changchun, Jilin 130021, P.R. China, Tel: +86 431 8566 2803, Email: [email protected]

Received Date: Mar 27, 2018 / Accepted Date: Jun 25, 2018 / Published Date: Jun 30, 2018

Abstract

Increasing researchers have identified that upregulation of neuropilin (NRP)/tolloid (TLL)-like 2 (NETO2) is associated with some of human cancers. However, the expression of NETO2 and its possible function in osteosarcoma (OS) remain unknown. Herein, this study aimed to investigate the expression and potential action of NETO2 in OS. In this study, the expression of NETO2 in clinical tissues based on Gene Expression Omnibus (GEO) data and its expression level in OS cells were investigated. The effect of knockdown of NETO2 using small interference RNA (siRNA) method on OS cells proliferation and migration was assessed by CCK-8 and scratch wound analyses. Key molecules of mitogen-activated protein kinase kinase (MEK)/extracellular signal-regulated kinase (ERK) signaling pathway was measured by western blot assay. Our data determined that the expression of NETO2 in OS tissues was prominently higher than that in normal tissues. Consistently, overexpression of NETO2 was detected in OS cells compared with normal cells. Functionally, downregulation of NETO2 repressed OS cells proliferation and migration, which was modulated by MEK/ERK signaling. Our findings suggest that NETO2 may be utilized as a marker of OS and become a target for anti-cancer therapy.

Keywords: Osteosarcoma; NETO2; Proliferation; Migration

Introduction

Osteosarcoma (OS) is known as the commonest primary malignant bone tumor and causes substantial number of bone cancer-associated deaths in children and adolescents, which is largely ascribed to its recurrence and metastasis [1-5]. There are limited efficacy in current regiments, for example surgical resection and adjuvant chemotherapy in the treating metastatic and recurrent OS [6,7]. Hereby, there is urgent to have a good understanding of its potential molecular mechanism, attempting to develop novel potential therapeutic targets for OS.

Neuropilin (NRP)/tolloid (TLL)-like 2 (NETO2), also termed as BTCL2, encodes a brain-specific transmembrane protein. It is identified as an auxiliary subunit with kainate-type glutamate receptors (KARs) to regulate biophysical properties of KARs, including GluK1-K5 [8-11]. It has been documented that expression of KARs is determined in pediatric CNS tumors, which indicates interference with glutamate signaling may suppress tumor growth [12]. There is an evidence demonstrating that a substantial increase in NETO2 mRNA level is detected in renal cancer and it is found to be upregulated in cervical carcinoma and colon cancer, suggesting NETO2 is considered as a potential marker for these cancer [13]. Another report has confirmed that upregulation of NETO2 expression is associated with tumor progression and poor prognosis in colorectal carcinoma [14]. Increased expression of NETO2 has also been reported to be involved in proliferating hemangiomas [15]. Nonetheless, there is no available information to show NETO2 influencing OS progression.

To this end, the goal of this study was to explore the possible involvement of NETO2 in OS proliferation and migration and the potential mechanism involved. In this study, we firstly analyzed the data downloaded from specific Gene Expression Omnibus (GEO) OS tissue datasets. Our data demonstrated that NETO2 was upregulated in OS tissues compared to normal tissues, thus showing a gene expression pattern of a tumor promoter gene. Elevated expression of NETO2 was observed in OS cells in contrast with normal cells. Functional analyses showed that knockdown of NETO2 constructed using small interference RNA (siRNA) approach inhibited OS cells proliferation and migration, which was regulated by inactivation of mitogen-activated protein kinase kinase (MEK)/extracellular signal-regulated kinase (ERK) signaling. Our investigations indicate that NETO2 exhibits an oncogenic role in OS and thus it might serve as a therapeutic target for OS.

Materials and Methods

Dataset analysis

The mRNA expression patterns in OS tissues and normal tissues available at the GEO datasets (GSE28424, GSE36001 and GSE49003) were analyzed by GEO online analysis tool GEO2R performing differential gene analysis.

Cell lines and cell culture

OS cell line Saos-2, MG-63, and human osteoblast cells hFOB 1.19 were purchased from (Cell Bank of Chinese Academy of Sciences, Shanghai, China). All cells were cultured in Dulbecco’s modified eagle medium (DMEM; Thermo Fisher Scientific, Waltham, MA, USA), supplemented with 10% fetal bovine serum (FBS, Thermo), penicillin (100 U/ mL), and streptomycin (100 mg/mL; Thermo) in a 37°C incubator with 5% CO2.

NETO2 knock-down by small interference RNA (siRNA)

siRNAs were chemically synthesized from Genepharma Co. Ltd (Shanghai, China). The sequences (sense/antisense) for the siRNAs were as follows: si-NETO2 1: 5’-UAACA GUACU GGUAG UGGA-3’/5’-UCCAC UACCA GUACU GUUA-3’; siENTO2 2: 5’-UCAAG CAUAU UCCUG CAAC- 3’/5’-GUUGC AGGAA UAUGC UUGA - 3’. Non-targeting siRNA controls (si-con) : 5’- UCAUA ACGUG GAUCG AUUC -3’/5’- GAAUC GAUCC ACGUU AUGA -3’. The transfection of si-NETO2 1/2 and si-con were performed with Lipofectamine 2000 (Thermo) according to the manufacturer’s introductions. These cells were then collected 24 h after transfection to identify the efficiency of siRNA by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot analyses.

qRT-PCR analysis

Total RNA from cultured cells was extracted using Trizol reagent (Thermo) in accordance with the manufacturer’s protocol. qRT-PCR was performed to synthesize and then amplify the cDNA using the PrimeScript™ RT reagent kit and SYBR Premix Ex Taq kit (TaKaRa Biotechnology, Shiga, Japan) on an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The conditions of qPCR were as follows: 94°C for 10 min, 40 cycles of 94°C for 15 s, 60°C for 30 s. The primers are as follows: NETO2: F: 5’- GGCGTGAAAAGCCCTCCATT -3’, R: 5’- GCTCCCGAGAGCTCGAA -3’; GAPDH: F: 5’-GGAGCGAGATCCCTCCAA AAT -3’, R: 5’-GGCTGTTGTCATACTTCTCATGG-3’. The relative expression levels of the mRNA were calculated using the 2-ΔΔCt method.

Cell Counting Kit-8

Cells treated with si-NETO2 and si-con was plated at a density of 3 × 103 cells/well in 96-well plates. At the different time points after transfection, 10 μL of CCK-8 solution (Dojindo Molecular Technologies, Kumamoto, Japan) was added to each well and the cells were incubated for 1 h at 37°C. The optical density (OD) was measured at 450 nm.

Scratch wound assay

Cells were cultured in 6-well plates in complete medium until they reached 90% confluence. The monolayer cell culture was scratched by a 200 μL pipette tip with a uniform wound. The stripped cells were washed away with serum-free culture medium, and the other cells were cultured in medium containing 10% FBS. Images were captured under an Olympus microscope (Olympus, Japan) at 0 and 24 h after scratch. Migration rate was calculated as: (Migrated distance at measured timeinitial distance)/Initial distance × 100%.

Western blot analysis

Total proteins from cultured cells were extracted using radioimmunoprecipitation (RIPA) assay lysis buffer (Beyotime Institute of Biotechnology, Shanhai, China). Then, the protein concentration was quantified using bicinchoninic acid (BCA) method (Beyotime). Equal amounts of proteins (20 μg) were subjected to 10-12% sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA). The membranes were blocked with 5% non-fat milk, followed by incubation with corresponding diluted primary antibodies (anti-MEK, 1:1,000, ; anti-ERK, 1:1,000; antiphosphorylated (p-)MEK and anti-p-ERK, 1:1000; anti-NETO2, 1:1000, Cell Signaling Technology, Danvers, MA, USA; anti-GAPDH, 1:1000, Beyotime) at 4°C overnight. The membranes were incubated with horseradish peroxidase-labeled secondary antibody (Beyotime) at 37°C for 2 h. Proteins were visualized using electrochemiluminescence (ECL) reagents (Pierce Biotechnology, Inc., Rockford, IL, USA), and the scanned images were analyzed with Quantity One software (Bio- Rad Laboratories, Hercules, CA, USA).

Statistical analysis

Statistical analysis was done with using SPSS version 22.0 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism 6.0 (San Diego, CA, USA). All experiments were performed in triplicate. Data was expressed as mean and standard deviation (SD). Differences between means were studied using a Student t-test when two groups were compared. P value<0.05 was considered to be statistically significant.

Results

Upregulated expression of NETO2 in OS tissues and cells

The analysis of the available clinical including OS tissues/normal and metastatic/ non-metastatic samples showed that a significant increase of NETO2 in OS tissues relative to normal tissue (Figures 1A- 1C, P<0.01). Moreover, to validate our initial expression profiling data, we performed qRT-PCR of OS cells and observed significant enhanced expression of NETO2 in OS cells compared with normal cells (Figure 1D, P<0.01). These data suggest a potential oncogenic role played by NETO2 in OS.

NETO2 silencing impairs proliferation ability of OS cells

After identifying and confirming differential expression of NETO2 in OS tissues and cells, the effect of NETO2 on OS cells proliferation was determined. Firstly, we successfully knocked down it by observing a decreased level of NETO2 both in mRNA and protein level after transfection of si-NETO2 1/2 (Figures 2A and 2B, P<0.01). We chose one of si-NETO2 1/2 which named as si-NETO2 to perform the subsequent experiments. Furthermore, OD values of OS cells measured by CCK-8 assay showed that reduced OD values was observed in si- NETO2 group compared with si-con group with a time-dependent manner (Figure 2C, P<0.01). All results indicate that NETO2 silencing could inhibit OS cell proliferation.

NETO2 silencing decreases migration ability

To further determine NETO2 influencing OS cell migration capability, scratch wound assay was performed. The results showed that a lower migration distance was detected in si-NETO2 group on comparing si-con group (Figure 3). The result suggests a suppressive role of NETO2 silencing in OS cell migration property.

NETO2 silencing inhibited cell proliferation and migration via suppression of the MEK/ERK pathway

Emerging evidence has reported that MEK/ERK signaling pathway is vital of cancers development, including OS. We next examined the underlying molecular mechanism that contributed to the effects of NETO2 silencing on OS proliferation and migration. After siRNAmediated silencing of NETO2 expression, western blot assay showed that detectable decreased changes in p-MEK and p-ERK, but not MEK and ERK, in si-NETO2 group in contrast with si-con group (Figure 4, P<0.01). Thus, these data suggest that MEK/ERK signaling is of importance in the process of NETO2-mediated OS cell proliferation and migration.

Discussion

Here we present the first study of the role of NETO2 in OS. In the present study, we identified an elevation of NETO2 in OS tissues and cells. In addition, knockdown of NETO2 inhibited OS cells proliferation and migration. Molecularly, NETO2 silencing resulted in a suppressive effect on MEK/ERK signaling pathway in OS cells. Our results indicate that NETO2 may function as an oncogene in OS, implying it will be a potential therapeutic target for the treatment of OS patients.

Cancer initiations and developments is a complex pathogenesis process, implicated various molecules and biological networks, and OS is no exception. It is beyond doubt that bioinformatics provides an expedient tool for studying available molecules. We analyzed herein the mRNA expression patterns in OS tissues and normal samples available from GEO datasets. The data showed that an upregulated level of NETO2 was identified in OS tissues comparing with normal samples. To confirm it, we performed qRT-PCR to measure NETO2 mRNA expression level in OS cells. As expected, the result showed that NETO2 was significantly higher in OS cells than normal cells. Previous studies have suggested that NETO2 is overexpressed in a variety of cancers, but no reports about effect of it on OS progression. Thereby, this study offers a good insight for comprehending the biological function of NETO2 on OS.

It is well-known that uncontrollable proliferation and aggressive migration are tightly correlated with knotty metastatic and recurrent OS [16,17]. Hence, to address it, we assessed the effect of NETO2 on OS proliferation and migration. OD values in OS cells showed that an obvious decreased OD value in si-NETO2 group was detected on comparing with si-con group. Additionally, the result in scratch wound assay suggested a delayed migration closure in si-NETO2 group in contrast with si-con group. In short, these data indicate that NETO2 could exert an inhibitory role in OS proliferation and migration.

Having well-documented that MEK/ERK signaling is crucial for cancer progression, to explore the mechanism underlying NETO2- induced OS cell proliferation and migration, we examined its effect on MEK/ERK signaling. In this work, hallmarks of this signaling including MEK/p-MEK and ERK/p-ERK were measured. The result of western blot analysis showed that p-MEK and p-ERK were significantly increased insi-NETO2 group on comparing si-con group while there were no obvious differences of MEK and ERK in two groups. A previous study has suggested that inhibition in MEK/ERK signaling activity mediates repression in OS metastasis capability [18]. Another report has demonstrated that MEK1/2 and ERK1/2 phosphorylation are involved in Ewing sarcoma metastasis [19]. Altogether, our data in combination with previous studies suggests that MEK/ERK is participated in NETO2 facilitating OS progression. In spite of this, our current knowledge of the mechanisms responsible for these events and the regulatory components involved is still rudimentary at best and further deeper investigations is necessary [20-28].

Conclusion

Collectively, our present study demonstrated that NETO2, which was markedly overexpressed in OS tissues and cells, played a significant role in OS proliferation and migration through the MEK/ ERK pathway. A schematic flochart (Figure 5) was used to ravel out our findings. Therefore, these results shed some light on NETO2 possibly emerging as a promising therapeutic target for treating OS patients in the further clinics. However, our preliminary work still exists some of limitations. Namely, this study is mainly performed in only one cell line, thus more cell lines are required to confirm these determinations. More functional analyses still need in the further studies.

Declaration of Interest

The authors declare that they have no competing interests.

Authors’ Contributions

ZMS and TLW designed the study. TLW and TSW performed experiments and wrote the manuscript. XNZ performed the experiments and analyzed the data. All authors have read and agreed the final manuscript.

Availability of Data and Materials

All data generated or analyzed during this study are included in this published article.

Consent to Publish

All authors agree to the publication.

References

Citation: Wu TL, Wu TS, Zhang XN, Song ZM (2018) High Expression of NETO2 in Osteosarcoma Promotes Cell Proliferation and Migration. Cell Mol Biol 64:147. DOI: 10.4172/1165-158X.1000147

Copyright: © 2018 Wu TL, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Select your language of interest to view the total content in your interested language

Post Your Comment Citation
Share This Article
Relevant Topics
Article Usage
  • Total views: 233
  • [From(publication date): 0-0 - Jan 24, 2019]
  • Breakdown by view type
  • HTML page views: 210
  • PDF downloads: 23

Post your comment

captcha   Reload  Can't read the image? click here to refresh
Leave Your Message 24x7